Incidental Mutation 'R8327:Ccdc187'
ID 644141
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26280618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 616 (H616R)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably benign
Transcript: ENSMUST00000057224
AA Change: H616R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: H616R

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: H616R
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: H655R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mast3 T C 8: 70,779,418 D1305G probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Reep2 A G 18: 34,842,513 N31S probably damaging Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tmem181a T C 17: 6,301,405 L353P probably damaging Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp638 T G 6: 83,928,697 L44W probably damaging Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTCAAAGGTTGGCTGATCC -3'
(R):5'- TTTGTGCAGAGGTCCAGTCC -3'

Sequencing Primer
(F):5'- CAAAGGTTGGCTGATCCTCTTTTTG -3'
(R):5'- CCTCCAGCAAGGGCAAAAGTG -3'
Posted On 2020-09-02