Incidental Mutation 'R8327:Zfp638'
ID 644151
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Name zinc finger protein 638
Synonyms Np220, Zfml
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83867109-83989550 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 83928697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 44 (L44W)
Ref Sequence ENSEMBL: ENSMUSP00000145513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204202] [ENSMUST00000204415] [ENSMUST00000204751]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032088
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113836
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect probably benign
Transcript: ENSMUST00000203324
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203455
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000203891
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204202
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204415
AA Change: L44W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145513
Gene: ENSMUSG00000030016
AA Change: L44W

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 112 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204751
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Ccdc187 T C 2: 26,280,618 H616R probably benign Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mast3 T C 8: 70,779,418 D1305G probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Reep2 A G 18: 34,842,513 N31S probably damaging Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tmem181a T C 17: 6,301,405 L353P probably damaging Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 splice site probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83976272 missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83979214 missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83929819 missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83977409 missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83929731 missense possibly damaging 0.85
R8384:Zfp638 UTSW 6 83979765 missense probably benign 0.28
R8703:Zfp638 UTSW 6 83977161 missense probably damaging 0.96
R8738:Zfp638 UTSW 6 83954763 critical splice donor site probably null
R8865:Zfp638 UTSW 6 83977053 missense possibly damaging 0.91
R8874:Zfp638 UTSW 6 83969153 missense probably damaging 1.00
R9080:Zfp638 UTSW 6 83867173 missense unknown
R9113:Zfp638 UTSW 6 83976912 missense probably damaging 0.96
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTCGGCAATGTACATG -3'
(R):5'- GGTCTCGACATGGCTACTTTC -3'

Sequencing Primer
(F):5'- CAGCTCGGCAATGTACATGAACTTG -3'
(R):5'- GGCTACTTTCAAGAATGCCTG -3'
Posted On 2020-09-02