Incidental Mutation 'R8327:Zscan5b'
ID 644153
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfg1, Zfp371
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6222278-6239423 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6233947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 232 (P232S)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Ccdc187 T C 2: 26,280,618 H616R probably benign Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mast3 T C 8: 70,779,418 D1305G probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Reep2 A G 18: 34,842,513 N31S probably damaging Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tmem181a T C 17: 6,301,405 L353P probably damaging Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp638 T G 6: 83,928,697 L44W probably damaging Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6231422 missense probably benign 0.00
R0505:Zscan5b UTSW 7 6239075 missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6233912 missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6230426 missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6233851 missense probably benign 0.00
R1613:Zscan5b UTSW 7 6230375 missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6239163 missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6238966 missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6231443 missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6239190 makesense probably null
R5624:Zscan5b UTSW 7 6230519 missense probably benign 0.00
R8213:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6238835 missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6231473 missense probably benign 0.00
R9717:Zscan5b UTSW 7 6231526 missense possibly damaging 0.73
X0018:Zscan5b UTSW 7 6230276 missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6238949 missense probably benign 0.00
X0025:Zscan5b UTSW 7 6238615 missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6230217 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATCTCTCCGTGGAACAAAC -3'
(R):5'- CTGCAATTCGGGTATAAAGTGAAC -3'

Sequencing Primer
(F):5'- GTGGAACAAACACACAACCATGATTG -3'
(R):5'- TCAACTCTGGTGTTGGCT -3'
Posted On 2020-09-02