Incidental Mutation 'R8327:Zscan5b'
ID 644153
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfp371, Zfg1
MMRRC Submission 067858-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6225277-6242416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6236946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 232 (P232S)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,331,685 (GRCm39) D843V possibly damaging Het
6330409D20Rik T A 2: 32,627,623 (GRCm39) Q111L unknown Het
Abcc5 C A 16: 20,241,068 (GRCm39) R39L probably benign Het
Acbd3 C A 1: 180,566,158 (GRCm39) Q284K probably damaging Het
Adgrv1 C T 13: 81,593,462 (GRCm39) R4175H probably damaging Het
Ankrd27 T C 7: 35,300,985 (GRCm39) L95P probably damaging Het
Apc2 T G 10: 80,137,764 (GRCm39) D68E probably damaging Het
Apob A T 12: 8,051,015 (GRCm39) I1093F possibly damaging Het
Arid2 T A 15: 96,260,485 (GRCm39) D411E probably damaging Het
Astn1 T A 1: 158,436,850 (GRCm39) Y811N probably damaging Het
Calhm5 A C 10: 33,972,064 (GRCm39) F124V probably damaging Het
Ccdc187 T C 2: 26,170,630 (GRCm39) H616R probably benign Het
Ccdc198 C T 14: 49,470,356 (GRCm39) G197S possibly damaging Het
Clca4b T C 3: 144,627,762 (GRCm39) Y403C possibly damaging Het
Dagla C T 19: 10,228,451 (GRCm39) V656I probably benign Het
Dguok A C 6: 83,464,061 (GRCm39) W166G probably damaging Het
Dlg5 G A 14: 24,196,388 (GRCm39) A1603V probably damaging Het
Fanca G A 8: 124,039,984 (GRCm39) Q138* probably null Het
Fbxl19 T A 7: 127,347,520 (GRCm39) C25* probably null Het
Gm49383 C A 12: 69,243,643 (GRCm39) E79* probably null Het
Lcor C T 19: 41,570,996 (GRCm39) S63L probably damaging Het
Lrp2 T C 2: 69,322,268 (GRCm39) Y1887C probably damaging Het
Mast3 T C 8: 71,232,062 (GRCm39) D1305G probably damaging Het
Mreg C A 1: 72,203,257 (GRCm39) R107L possibly damaging Het
Nbn T A 4: 15,981,470 (GRCm39) S521T probably benign Het
Nxpe2 C A 9: 48,231,059 (GRCm39) V437L probably benign Het
Or2t49 T C 11: 58,392,942 (GRCm39) M153V probably benign Het
Or51s1 A T 7: 102,558,926 (GRCm39) I40N probably damaging Het
Or8c13 T C 9: 38,091,186 (GRCm39) E311G possibly damaging Het
Pcdhb5 A C 18: 37,453,953 (GRCm39) K111T probably benign Het
Pi4kb A G 3: 94,906,192 (GRCm39) I580V probably benign Het
Plaat3 T C 19: 7,556,514 (GRCm39) L105P probably benign Het
Rbm15b A G 9: 106,761,646 (GRCm39) S841P probably benign Het
Reep2 A G 18: 34,975,566 (GRCm39) N31S probably damaging Het
Scmh1 C T 4: 120,379,699 (GRCm39) H505Y probably benign Het
Setd1a T A 7: 127,390,669 (GRCm39) L1115H unknown Het
Slc26a3 A G 12: 31,516,430 (GRCm39) D596G possibly damaging Het
Smg5 G T 3: 88,252,714 (GRCm39) A167S probably damaging Het
Supv3l1 T C 10: 62,277,004 (GRCm39) T255A probably damaging Het
Synrg G A 11: 83,899,731 (GRCm39) A568T probably benign Het
Tmem132a G T 19: 10,836,311 (GRCm39) P740T probably benign Het
Tmem181a T C 17: 6,351,680 (GRCm39) L353P probably damaging Het
Tubgcp3 T C 8: 12,704,343 (GRCm39) E242G probably benign Het
Vmn2r77 A T 7: 86,450,680 (GRCm39) T189S probably benign Het
Zfp638 T G 6: 83,905,679 (GRCm39) L44W probably damaging Het
Zfp715 G A 7: 42,947,482 (GRCm39) T826I possibly damaging Het
Zfp865 G A 7: 5,034,058 (GRCm39) S681N probably benign Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6,234,421 (GRCm39) missense probably benign 0.00
R0505:Zscan5b UTSW 7 6,242,074 (GRCm39) missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6,236,911 (GRCm39) missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6,233,425 (GRCm39) missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6,236,850 (GRCm39) missense probably benign 0.00
R1613:Zscan5b UTSW 7 6,233,374 (GRCm39) missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6,242,162 (GRCm39) missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6,241,965 (GRCm39) missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6,234,442 (GRCm39) missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6,242,189 (GRCm39) makesense probably null
R5624:Zscan5b UTSW 7 6,233,518 (GRCm39) missense probably benign 0.00
R8213:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6,241,834 (GRCm39) missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6,234,472 (GRCm39) missense probably benign 0.00
R9717:Zscan5b UTSW 7 6,234,525 (GRCm39) missense possibly damaging 0.73
X0018:Zscan5b UTSW 7 6,233,275 (GRCm39) missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6,241,948 (GRCm39) missense probably benign 0.00
X0025:Zscan5b UTSW 7 6,241,614 (GRCm39) missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6,233,216 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATCTCTCCGTGGAACAAAC -3'
(R):5'- CTGCAATTCGGGTATAAAGTGAAC -3'

Sequencing Primer
(F):5'- GTGGAACAAACACACAACCATGATTG -3'
(R):5'- TCAACTCTGGTGTTGGCT -3'
Posted On 2020-09-02