Incidental Mutation 'R8327:Setd1a'
ID 644159
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 067858-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127390669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1115 (L1115H)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: L1115H
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: L1115H

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: L1115H
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: L1115H

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: L572H
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,331,685 (GRCm39) D843V possibly damaging Het
6330409D20Rik T A 2: 32,627,623 (GRCm39) Q111L unknown Het
Abcc5 C A 16: 20,241,068 (GRCm39) R39L probably benign Het
Acbd3 C A 1: 180,566,158 (GRCm39) Q284K probably damaging Het
Adgrv1 C T 13: 81,593,462 (GRCm39) R4175H probably damaging Het
Ankrd27 T C 7: 35,300,985 (GRCm39) L95P probably damaging Het
Apc2 T G 10: 80,137,764 (GRCm39) D68E probably damaging Het
Apob A T 12: 8,051,015 (GRCm39) I1093F possibly damaging Het
Arid2 T A 15: 96,260,485 (GRCm39) D411E probably damaging Het
Astn1 T A 1: 158,436,850 (GRCm39) Y811N probably damaging Het
Calhm5 A C 10: 33,972,064 (GRCm39) F124V probably damaging Het
Ccdc187 T C 2: 26,170,630 (GRCm39) H616R probably benign Het
Ccdc198 C T 14: 49,470,356 (GRCm39) G197S possibly damaging Het
Clca4b T C 3: 144,627,762 (GRCm39) Y403C possibly damaging Het
Dagla C T 19: 10,228,451 (GRCm39) V656I probably benign Het
Dguok A C 6: 83,464,061 (GRCm39) W166G probably damaging Het
Dlg5 G A 14: 24,196,388 (GRCm39) A1603V probably damaging Het
Fanca G A 8: 124,039,984 (GRCm39) Q138* probably null Het
Fbxl19 T A 7: 127,347,520 (GRCm39) C25* probably null Het
Gm49383 C A 12: 69,243,643 (GRCm39) E79* probably null Het
Lcor C T 19: 41,570,996 (GRCm39) S63L probably damaging Het
Lrp2 T C 2: 69,322,268 (GRCm39) Y1887C probably damaging Het
Mast3 T C 8: 71,232,062 (GRCm39) D1305G probably damaging Het
Mreg C A 1: 72,203,257 (GRCm39) R107L possibly damaging Het
Nbn T A 4: 15,981,470 (GRCm39) S521T probably benign Het
Nxpe2 C A 9: 48,231,059 (GRCm39) V437L probably benign Het
Or2t49 T C 11: 58,392,942 (GRCm39) M153V probably benign Het
Or51s1 A T 7: 102,558,926 (GRCm39) I40N probably damaging Het
Or8c13 T C 9: 38,091,186 (GRCm39) E311G possibly damaging Het
Pcdhb5 A C 18: 37,453,953 (GRCm39) K111T probably benign Het
Pi4kb A G 3: 94,906,192 (GRCm39) I580V probably benign Het
Plaat3 T C 19: 7,556,514 (GRCm39) L105P probably benign Het
Rbm15b A G 9: 106,761,646 (GRCm39) S841P probably benign Het
Reep2 A G 18: 34,975,566 (GRCm39) N31S probably damaging Het
Scmh1 C T 4: 120,379,699 (GRCm39) H505Y probably benign Het
Slc26a3 A G 12: 31,516,430 (GRCm39) D596G possibly damaging Het
Smg5 G T 3: 88,252,714 (GRCm39) A167S probably damaging Het
Supv3l1 T C 10: 62,277,004 (GRCm39) T255A probably damaging Het
Synrg G A 11: 83,899,731 (GRCm39) A568T probably benign Het
Tmem132a G T 19: 10,836,311 (GRCm39) P740T probably benign Het
Tmem181a T C 17: 6,351,680 (GRCm39) L353P probably damaging Het
Tubgcp3 T C 8: 12,704,343 (GRCm39) E242G probably benign Het
Vmn2r77 A T 7: 86,450,680 (GRCm39) T189S probably benign Het
Zfp638 T G 6: 83,905,679 (GRCm39) L44W probably damaging Het
Zfp715 G A 7: 42,947,482 (GRCm39) T826I possibly damaging Het
Zfp865 G A 7: 5,034,058 (GRCm39) S681N probably benign Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGCAGCACATCAGACTC -3'
(R):5'- CTTGACAAGGGCACAAGAGC -3'

Sequencing Primer
(F):5'- CACATCAGACTCCGAGAGTGG -3'
(R):5'- CACAAGAGCTCAGTCATGCGTTAG -3'
Posted On 2020-09-02