Incidental Mutation 'R8327:Mast3'
ID 644161
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene? Non essential (E-score: 0.000) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70779418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1305 (D1305G)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: D1321G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: D1321G

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: D1305G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Ccdc187 T C 2: 26,280,618 H616R probably benign Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Reep2 A G 18: 34,842,513 N31S probably damaging Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tmem181a T C 17: 6,301,405 L353P probably damaging Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp638 T G 6: 83,928,697 L44W probably damaging Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9148:Mast3 UTSW 8 70780447 missense probably damaging 0.98
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
R9779:Mast3 UTSW 8 70785483 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATTAGTCGCGAGGGCTTG -3'
(R):5'- AAGCAGTATCCCTCCATCTCCG -3'

Sequencing Primer
(F):5'- CGAGGGCTTGCTATTTACAAGTCAC -3'
(R):5'- TCTCCTAGGCTGCGTAGG -3'
Posted On 2020-09-02