Incidental Mutation 'R8327:Tmem181a'
ID644179
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8327 (G1)
Quality Score215.009
Status Not validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6301405 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 353 (L353P)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383] [ENSMUST00000232499]
Predicted Effect probably damaging
Transcript: ENSMUST00000088940
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: L353P

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232383
AA Change: L394P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232499
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Ccdc187 T C 2: 26,280,618 H616R probably benign Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mast3 T C 8: 70,779,418 D1305G probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Reep2 A G 18: 34,842,513 N31S probably damaging Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp638 T G 6: 83,928,697 L44W probably damaging Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
R8175:Tmem181a UTSW 17 6295800 missense probably benign 0.00
R8385:Tmem181a UTSW 17 6288999 missense probably benign 0.10
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAACCACTGTGTTGGCCC -3'
(R):5'- ACTCATGTTAACCCTCTGGC -3'

Sequencing Primer
(F):5'- TTGGCCCTGCTGTACGTAGC -3'
(R):5'- TGCATGCACATCCAGATACG -3'
Posted On2020-09-02