Incidental Mutation 'R0068:Hps5'
ID64418
Institutional Source Beutler Lab
Gene Symbol Hps5
Ensembl Gene ENSMUSG00000014418
Gene NameHPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonymsru-2, ru2, ruby eye 2
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0068 (G1)
Quality Score111
Status Validated
Chromosome7
Chromosomal Location46760466-46796064 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 46777042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014562] [ENSMUST00000107653] [ENSMUST00000107654] [ENSMUST00000142663] [ENSMUST00000211347]
Predicted Effect probably benign
Transcript: ENSMUST00000014562
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107653
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107654
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142663
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145776
Predicted Effect probably benign
Transcript: ENSMUST00000153789
SMART Domains Protein: ENSMUSP00000119876
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
low complexity region 241 252 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 449 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157026
Predicted Effect probably benign
Transcript: ENSMUST00000211347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Hps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 unclassified probably benign
smoky UTSW 7 46769351 nonsense probably null
Titan UTSW 7 46783469 critical splice donor site probably null
toffee UTSW 7 46777075 intron probably benign
wombat UTSW 7 46783634 missense probably damaging 1.00
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R0684:Hps5 UTSW 7 46783469 critical splice donor site probably null
R1159:Hps5 UTSW 7 46772554 unclassified probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3914:Hps5 UTSW 7 46783526 missense probably damaging 1.00
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R5876:Hps5 UTSW 7 46789196 missense probably damaging 1.00
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6129:Hps5 UTSW 7 46771774 missense probably benign
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGACCCTTGGACTTACATTTCCCTG -3'
(R):5'- GCTTGTTTTAAGAGGGCTGATTGCACAT -3'

Sequencing Primer
(F):5'- tcccccatctccctacaac -3'
(R):5'- GAGGGCTGATTGCACATATATTAAC -3'
Posted On2013-08-06