Incidental Mutation 'R8328:Hck'
ID644187
Institutional Source Beutler Lab
Gene Symbol Hck
Ensembl Gene ENSMUSG00000003283
Gene Namehemopoietic cell kinase
SynonymsBmk, Hck-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153108468-153151441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153129067 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 83 (A83V)
Ref Sequence ENSEMBL: ENSMUSP00000003370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003370] [ENSMUST00000109799] [ENSMUST00000189688] [ENSMUST00000191431]
Predicted Effect probably damaging
Transcript: ENSMUST00000003370
AA Change: A83V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003370
Gene: ENSMUSG00000003283
AA Change: A83V

DomainStartEndE-ValueType
SH3 79 135 6e-20 SMART
SH2 140 230 2.51e-33 SMART
TyrKc 260 509 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109799
AA Change: A62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105423
Gene: ENSMUSG00000003283
AA Change: A62V

DomainStartEndE-ValueType
SH3 58 114 6e-20 SMART
SH2 119 209 2.51e-33 SMART
TyrKc 239 488 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189688
AA Change: A62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141030
Gene: ENSMUSG00000003283
AA Change: A62V

DomainStartEndE-ValueType
SH3 58 114 6e-20 SMART
SH2 119 209 2.51e-33 SMART
TyrKc 239 488 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191431
AA Change: A83V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139988
Gene: ENSMUSG00000003283
AA Change: A83V

DomainStartEndE-ValueType
SH3 79 135 6e-20 SMART
SH2 140 230 2.51e-33 SMART
TyrKc 260 509 7.71e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may play a role in the innate immune response and the STAT5 signaling pathway. Alternative translation initiation site usage, including a non-AUG (CUG) codon, results in the production of two different isoforms, that have different subcellular localization. [provided by RefSeq, Feb 2010]
PHENOTYPE: Macrophages from mice homozygous for a targeted null mutation exhibit impaired phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Hck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Hck APN 2 153136733 missense probably benign 0.08
IGL00489:Hck APN 2 153151019 missense possibly damaging 0.80
IGL02682:Hck APN 2 153134134 missense probably damaging 0.98
PIT4466001:Hck UTSW 2 153124271 missense probably damaging 1.00
R0143:Hck UTSW 2 153134220 critical splice donor site probably null
R0441:Hck UTSW 2 153134132 missense probably benign 0.02
R1300:Hck UTSW 2 153134147 missense possibly damaging 0.94
R1366:Hck UTSW 2 153138295 missense probably damaging 1.00
R1445:Hck UTSW 2 153128272 missense probably benign 0.01
R1978:Hck UTSW 2 153129856 missense probably damaging 1.00
R4953:Hck UTSW 2 153134677 missense probably damaging 1.00
R5243:Hck UTSW 2 153144492 missense probably damaging 1.00
R5247:Hck UTSW 2 153134695 nonsense probably null
R5890:Hck UTSW 2 153129076 missense probably damaging 1.00
R7467:Hck UTSW 2 153129930 nonsense probably null
R7673:Hck UTSW 2 153129085 missense possibly damaging 0.95
R8399:Hck UTSW 2 153138317 missense probably damaging 0.99
X0025:Hck UTSW 2 153148968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTACCTGAGCTCCTTGCCC -3'
(R):5'- TGGTGTGCAGTCAGATTCTCATC -3'

Sequencing Primer
(F):5'- CCGGGCTCTTGTCTTTCTAGAATG -3'
(R):5'- CATTTACTCCCAGAATTAGGCTGTTG -3'
Posted On2020-09-02