Incidental Mutation 'R8328:Syde2'
ID644188
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146015741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1121 (V1121A)
Ref Sequence ENSEMBL: ENSMUSP00000041897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably benign
Transcript: ENSMUST00000039517
AA Change: V1121A

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863
AA Change: V1121A

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200546
AA Change: V853A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863
AA Change: V853A

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212479
AA Change: V854A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1535:Syde2 UTSW 3 146002421 splice site probably benign
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5086:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5101:Syde2 UTSW 3 146015638 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7191:Syde2 UTSW 3 146002358 missense probably benign 0.04
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
R7875:Syde2 UTSW 3 146020265 missense probably damaging 1.00
R7903:Syde2 UTSW 3 145998788 missense probably damaging 1.00
R7918:Syde2 UTSW 3 146002415 critical splice donor site probably null
R8016:Syde2 UTSW 3 146001972 missense possibly damaging 0.82
R8185:Syde2 UTSW 3 145988912 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACATCTAAGCACTTACTGGG -3'
(R):5'- CAGAGCAGGTCTCAATTCCTTAG -3'

Sequencing Primer
(F):5'- AGCACTTACTGGGTTAAATTGTG -3'
(R):5'- GTACTCCAGAGAATCCTCTAC -3'
Posted On2020-09-02