Incidental Mutation 'R8328:Ankrd6'
ID644189
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Nameankyrin repeat domain 6
Synonymsdiversin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location32804035-32950841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32810215 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 489 (E489K)
Ref Sequence ENSEMBL: ENSMUSP00000041300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
Predicted Effect probably benign
Transcript: ENSMUST00000035719
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: E489K

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084748
AA Change: E454K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: E454K

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084749
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: E489K

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084750
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: E489K

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108166
AA Change: E430K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: E430K

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32828774 missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32860411 missense probably damaging 1.00
R6345:Ankrd6 UTSW 4 32810266 missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32822231 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806420 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense probably benign
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32816949 missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32821298 missense probably damaging 0.99
R7496:Ankrd6 UTSW 4 32810299 missense probably damaging 0.99
R7662:Ankrd6 UTSW 4 32818694 missense probably damaging 1.00
R7873:Ankrd6 UTSW 4 32806499 missense possibly damaging 0.91
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Z1176:Ankrd6 UTSW 4 32806229 missense possibly damaging 0.86
Z1176:Ankrd6 UTSW 4 32806326 missense probably benign 0.08
Z1176:Ankrd6 UTSW 4 32824486 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACTACACATTCTTCGCTCCTAAC -3'
(R):5'- CGTGCTGTGAAATAGGGCAG -3'

Sequencing Primer
(F):5'- CTTTATTAGGGCTACAGAAACAACAG -3'
(R):5'- GAAGTCCTTTGTCTCTTTTGCAGAC -3'
Posted On2020-09-02