Mutagenetix > Incidental Mutation

Incidental Mutation 'R8328:Ankrd6'

644189

Institutional Source

Beutler Lab

Gene Symbol

Ankrd6

Ensembl Gene

ENSMUSG00000040183

Gene Name

ankyrin repeat domain 6

Synonyms

diversin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32804035-32950841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32810215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 489 (E489K)

Ref Sequence

ENSEMBL: ENSMUSP00000041300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]

AlphaFold

Q69ZU8

Predicted Effect

probably benign
Transcript: ENSMUST00000035719
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: E489K

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084748
AA Change: E454K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: E454K

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	269	2.11e2	SMART
low complexity region	330	342	N/A	INTRINSIC
coiled coil region	382	410	N/A	INTRINSIC
low complexity region	501	521	N/A	INTRINSIC
low complexity region	590	608	N/A	INTRINSIC
coiled coil region	637	677	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084749
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: E489K

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084750
AA Change: E489K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: E489K

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108166
AA Change: E430K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: E430K

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	3.74e0	SMART
ANK	140	169	6.12e-5	SMART
ANK	173	202	5.32e-5	SMART
low complexity region	207	227	N/A	INTRINSIC
low complexity region	306	318	N/A	INTRINSIC
coiled coil region	358	386	N/A	INTRINSIC
low complexity region	468	491	N/A	INTRINSIC
low complexity region	561	579	N/A	INTRINSIC
coiled coil region	608	648	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	T	6: 92,890,012	M682K	probably benign	Het
Ankdd1b	T	A	13: 96,454,866	I42F	possibly damaging	Het
Arhgef28	A	T	13: 98,051,009	H259Q	possibly damaging	Het
C3	T	C	17: 57,220,973	S749G	probably benign	Het
Celsr1	A	G	15: 85,922,244	S2338P	probably benign	Het
Ces2a	A	T	8: 104,737,366	N210I	probably damaging	Het
Cuzd1	A	T	7: 131,311,616	V424D	probably damaging	Het
Cyp2j11	T	A	4: 96,348,368	H67L	probably benign	Het
Dennd5b	A	G	6: 149,020,617	S800P	probably damaging	Het
Dmrta2	G	T	4: 109,980,009	L49F	unknown	Het
Dpy19l1	T	A	9: 24,475,390	K9*	probably null	Het
Dsc2	T	C	18: 20,032,519	H843R	possibly damaging	Het
Dsg1b	T	A	18: 20,376,950	F6I	probably benign	Het
Fam214b	T	C	4: 43,034,751	T323A	probably benign	Het
Gm13084	A	G	4: 143,810,810	L317P	probably damaging	Het
Hck	C	T	2: 153,129,067	A83V	probably damaging	Het
Hdc	T	C	2: 126,601,883	E292G	probably damaging	Het
Ighv1-23	A	G	12: 114,764,496	L102P	probably damaging	Het
Kdm3b	G	A	18: 34,793,070	V88M	probably damaging	Het
Kremen2	A	G	17: 23,742,771	V254A	probably benign	Het
Lrrc8e	T	A	8: 4,235,641	I622N	probably damaging	Het
Megf8	A	G	7: 25,347,492	N1600S	probably benign	Het
Mical3	A	G	6: 120,935,177	I1907T	probably damaging	Het
Nr4a3	T	A	4: 48,051,323	Y26N	probably damaging	Het
Nrl	T	C	14: 55,520,706	E188G	probably damaging	Het
Olfr311	T	A	11: 58,841,634	D173E	probably benign	Het
Olfr464	A	G	11: 87,914,159	M249T	possibly damaging	Het
Polr1a	G	A	6: 71,920,734	E238K	probably benign	Het
Prr5	G	C	15: 84,703,186	*388S	probably null	Het
Rptor	A	G	11: 119,892,647	T1156A	probably benign	Het
Slc9c1	T	A	16: 45,577,864	I664K	probably damaging	Het
Stn1	C	A	19: 47,517,059	R152L	probably damaging	Het
Syde2	T	C	3: 146,015,741	V1121A	probably benign	Het
Vmn1r158	T	C	7: 22,790,062	T241A	probably damaging	Het
Vmn1r209	C	A	13: 22,806,473	V16L	probably benign	Het
Wdr19	A	G	5: 65,225,295	E454G	probably damaging	Het
Zan	C	T	5: 137,394,464	E4590K	unknown	Het
Zfp579	T	G	7: 4,994,867	H15P	unknown	Het
Zfp628	A	G	7: 4,919,814	N345S	probably benign	Het
Zfp944	T	A	17: 22,339,724	K181*	probably null	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Ankrd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02489:Ankrd6	APN	4	32810298	missense	probably damaging	1.00
IGL03247:Ankrd6	APN	4	32860441	start codon destroyed	possibly damaging	0.76
IGL03382:Ankrd6	APN	4	32808771	missense	probably damaging	1.00
R0360:Ankrd6	UTSW	4	32836424	missense	probably damaging	1.00
R0711:Ankrd6	UTSW	4	32815326	missense	probably damaging	1.00
R1074:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1075:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1498:Ankrd6	UTSW	4	32810289	missense	probably benign	0.17
R1719:Ankrd6	UTSW	4	32828774	missense	probably damaging	1.00
R1823:Ankrd6	UTSW	4	32824427	missense	probably damaging	1.00
R2889:Ankrd6	UTSW	4	32818704	missense	probably damaging	0.99
R2897:Ankrd6	UTSW	4	32860438	missense	probably damaging	0.98
R3815:Ankrd6	UTSW	4	32806206	missense	probably benign	0.39
R3836:Ankrd6	UTSW	4	32817531	missense	probably damaging	1.00
R4127:Ankrd6	UTSW	4	32822241	missense	probably damaging	1.00
R4994:Ankrd6	UTSW	4	32860387	missense	probably damaging	0.99
R5250:Ankrd6	UTSW	4	32860335	missense	probably damaging	1.00
R5291:Ankrd6	UTSW	4	32823446	missense	probably damaging	1.00
R5335:Ankrd6	UTSW	4	32818651	missense	probably damaging	1.00
R5948:Ankrd6	UTSW	4	32817075	missense	possibly damaging	0.91
R6336:Ankrd6	UTSW	4	32860411	missense	probably damaging	1.00
R6345:Ankrd6	UTSW	4	32810266	missense	probably damaging	1.00
R6349:Ankrd6	UTSW	4	32822231	missense	probably damaging	1.00
R6516:Ankrd6	UTSW	4	32836427	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806419	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806420	missense	probably damaging	1.00
R6999:Ankrd6	UTSW	4	32823459	missense	probably benign
R7044:Ankrd6	UTSW	4	32815260	missense	possibly damaging	0.93
R7307:Ankrd6	UTSW	4	32816949	missense	possibly damaging	0.92
R7394:Ankrd6	UTSW	4	32821298	missense	probably damaging	0.99
R7496:Ankrd6	UTSW	4	32810299	missense	probably damaging	0.99
R7662:Ankrd6	UTSW	4	32818694	missense	probably damaging	1.00
R7873:Ankrd6	UTSW	4	32806499	missense	possibly damaging	0.91
R8739:Ankrd6	UTSW	4	32806337	missense	possibly damaging	0.47
R8937:Ankrd6	UTSW	4	32823452	missense	possibly damaging	0.95
R9211:Ankrd6	UTSW	4	32806580	missense	probably damaging	1.00
R9295:Ankrd6	UTSW	4	32822160	missense	probably damaging	0.98
R9319:Ankrd6	UTSW	4	32806324	missense	probably benign	0.02
R9702:Ankrd6	UTSW	4	32810202	missense	possibly damaging	0.49
R9741:Ankrd6	UTSW	4	32860339	nonsense	probably null
X0064:Ankrd6	UTSW	4	32806435	missense	possibly damaging	0.93
Z1176:Ankrd6	UTSW	4	32806229	missense	possibly damaging	0.86
Z1176:Ankrd6	UTSW	4	32806326	missense	probably benign	0.08
Z1176:Ankrd6	UTSW	4	32824486	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGACTACACATTCTTCGCTCCTAAC -3'
(R):5'- CGTGCTGTGAAATAGGGCAG -3'

Sequencing Primer
(F):5'- CTTTATTAGGGCTACAGAAACAACAG -3'
(R):5'- GAAGTCCTTTGTCTCTTTTGCAGAC -3'

Posted On

2020-09-02