Incidental Mutation 'R8328:Pramel26'
ID 644194
Institutional Source Beutler Lab
Gene Symbol Pramel26
Ensembl Gene ENSMUSG00000059218
Gene Name PRAME like 26
Synonyms Gm13084
MMRRC Submission 067727-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143535817-143542663 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143537380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 317 (L317P)
Ref Sequence ENSEMBL: ENSMUSP00000074557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
AlphaFold A2A8N0
Predicted Effect probably damaging
Transcript: ENSMUST00000075045
AA Change: L317P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: L317P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105769
AA Change: L317P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: L317P

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,866,993 (GRCm39) M682K probably benign Het
Ankdd1b T A 13: 96,591,374 (GRCm39) I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 (GRCm39) E489K probably benign Het
Arhgef28 A T 13: 98,187,517 (GRCm39) H259Q possibly damaging Het
Atosb T C 4: 43,034,751 (GRCm39) T323A probably benign Het
C3 T C 17: 57,527,973 (GRCm39) S749G probably benign Het
Celsr1 A G 15: 85,806,445 (GRCm39) S2338P probably benign Het
Ces2a A T 8: 105,463,998 (GRCm39) N210I probably damaging Het
Cuzd1 A T 7: 130,913,345 (GRCm39) V424D probably damaging Het
Cyp2j11 T A 4: 96,236,605 (GRCm39) H67L probably benign Het
Dennd5b A G 6: 148,922,115 (GRCm39) S800P probably damaging Het
Dmrta2 G T 4: 109,837,206 (GRCm39) L49F unknown Het
Dpy19l1 T A 9: 24,386,686 (GRCm39) K9* probably null Het
Dsc2 T C 18: 20,165,576 (GRCm39) H843R possibly damaging Het
Dsg1b T A 18: 20,510,007 (GRCm39) F6I probably benign Het
Hck C T 2: 152,970,987 (GRCm39) A83V probably damaging Het
Hdc T C 2: 126,443,803 (GRCm39) E292G probably damaging Het
Ighv1-23 A G 12: 114,728,116 (GRCm39) L102P probably damaging Het
Kdm3b G A 18: 34,926,123 (GRCm39) V88M probably damaging Het
Kremen2 A G 17: 23,961,745 (GRCm39) V254A probably benign Het
Lrrc8e T A 8: 4,285,641 (GRCm39) I622N probably damaging Het
Megf8 A G 7: 25,046,917 (GRCm39) N1600S probably benign Het
Mical3 A G 6: 120,912,138 (GRCm39) I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 (GRCm39) Y26N probably damaging Het
Nrl T C 14: 55,758,163 (GRCm39) E188G probably damaging Het
Or4d1 A G 11: 87,804,985 (GRCm39) M249T possibly damaging Het
Or9e1 T A 11: 58,732,460 (GRCm39) D173E probably benign Het
Polr1a G A 6: 71,897,718 (GRCm39) E238K probably benign Het
Prr5 G C 15: 84,587,387 (GRCm39) *388S probably null Het
Rptor A G 11: 119,783,473 (GRCm39) T1156A probably benign Het
Slc9c1 T A 16: 45,398,227 (GRCm39) I664K probably damaging Het
Stn1 C A 19: 47,505,498 (GRCm39) R152L probably damaging Het
Syde2 T C 3: 145,721,496 (GRCm39) V1121A probably benign Het
Vmn1r158 T C 7: 22,489,487 (GRCm39) T241A probably damaging Het
Vmn1r209 C A 13: 22,990,643 (GRCm39) V16L probably benign Het
Wdr19 A G 5: 65,382,638 (GRCm39) E454G probably damaging Het
Zan C T 5: 137,392,726 (GRCm39) E4590K unknown Het
Zfp579 T G 7: 4,997,866 (GRCm39) H15P unknown Het
Zfp628 A G 7: 4,922,813 (GRCm39) N345S probably benign Het
Zfp944 T A 17: 22,558,705 (GRCm39) K181* probably null Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Pramel26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pramel26 APN 4 143,539,293 (GRCm39) missense probably benign 0.32
IGL01075:Pramel26 APN 4 143,538,216 (GRCm39) missense possibly damaging 0.47
IGL02705:Pramel26 APN 4 143,537,372 (GRCm39) missense probably damaging 1.00
IGL03011:Pramel26 APN 4 143,538,330 (GRCm39) missense possibly damaging 0.95
PIT4498001:Pramel26 UTSW 4 143,539,406 (GRCm39) missense possibly damaging 0.63
R0268:Pramel26 UTSW 4 143,537,338 (GRCm39) missense probably damaging 1.00
R0344:Pramel26 UTSW 4 143,537,338 (GRCm39) missense probably damaging 1.00
R0390:Pramel26 UTSW 4 143,538,269 (GRCm39) missense probably benign 0.09
R0597:Pramel26 UTSW 4 143,539,222 (GRCm39) missense probably damaging 0.98
R0646:Pramel26 UTSW 4 143,539,155 (GRCm39) missense possibly damaging 0.83
R0927:Pramel26 UTSW 4 143,539,378 (GRCm39) missense probably benign 0.05
R0973:Pramel26 UTSW 4 143,538,428 (GRCm39) missense probably damaging 1.00
R1851:Pramel26 UTSW 4 143,539,396 (GRCm39) missense probably benign 0.33
R1852:Pramel26 UTSW 4 143,539,396 (GRCm39) missense probably benign 0.33
R3699:Pramel26 UTSW 4 143,536,922 (GRCm39) missense probably benign 0.05
R3705:Pramel26 UTSW 4 143,538,345 (GRCm39) missense probably benign 0.06
R3845:Pramel26 UTSW 4 143,538,545 (GRCm39) missense probably damaging 0.96
R4035:Pramel26 UTSW 4 143,537,026 (GRCm39) missense probably benign 0.08
R4044:Pramel26 UTSW 4 143,538,170 (GRCm39) missense probably benign 0.34
R4439:Pramel26 UTSW 4 143,538,143 (GRCm39) missense possibly damaging 0.49
R4660:Pramel26 UTSW 4 143,538,435 (GRCm39) missense probably benign 0.19
R4770:Pramel26 UTSW 4 143,538,519 (GRCm39) missense probably damaging 0.96
R4838:Pramel26 UTSW 4 143,537,375 (GRCm39) nonsense probably null
R5534:Pramel26 UTSW 4 143,539,169 (GRCm39) nonsense probably null
R5691:Pramel26 UTSW 4 143,538,579 (GRCm39) missense probably benign 0.44
R5893:Pramel26 UTSW 4 143,537,038 (GRCm39) missense probably damaging 1.00
R6123:Pramel26 UTSW 4 143,539,334 (GRCm39) missense possibly damaging 0.89
R6285:Pramel26 UTSW 4 143,542,609 (GRCm39) missense probably damaging 1.00
R6886:Pramel26 UTSW 4 143,539,332 (GRCm39) missense probably benign 0.29
R7105:Pramel26 UTSW 4 143,537,341 (GRCm39) missense probably benign 0.04
R7135:Pramel26 UTSW 4 143,537,233 (GRCm39) missense probably damaging 1.00
R7474:Pramel26 UTSW 4 143,538,269 (GRCm39) missense probably benign 0.03
R7594:Pramel26 UTSW 4 143,539,286 (GRCm39) missense probably damaging 0.99
R7610:Pramel26 UTSW 4 143,539,436 (GRCm39) missense probably damaging 1.00
R7635:Pramel26 UTSW 4 143,536,987 (GRCm39) missense probably damaging 1.00
R7682:Pramel26 UTSW 4 143,537,290 (GRCm39) missense probably benign 0.38
R7986:Pramel26 UTSW 4 143,538,590 (GRCm39) nonsense probably null
R8222:Pramel26 UTSW 4 143,536,893 (GRCm39) missense possibly damaging 0.61
R8678:Pramel26 UTSW 4 143,538,576 (GRCm39) missense probably benign 0.21
R8887:Pramel26 UTSW 4 143,539,257 (GRCm39) missense probably damaging 0.99
R8942:Pramel26 UTSW 4 143,536,861 (GRCm39) missense probably benign 0.00
R9219:Pramel26 UTSW 4 143,537,303 (GRCm39) missense probably benign 0.02
R9291:Pramel26 UTSW 4 143,539,251 (GRCm39) missense probably benign 0.13
R9649:Pramel26 UTSW 4 143,542,609 (GRCm39) missense probably damaging 1.00
R9746:Pramel26 UTSW 4 143,536,886 (GRCm39) missense probably benign 0.24
Z1177:Pramel26 UTSW 4 143,538,588 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACATTGACTTAGGGCAGGCAG -3'
(R):5'- ACAGAAGGCAATGTCCTGGG -3'

Sequencing Primer
(F):5'- GGCATTGAAGTGAGTTTCCCCC -3'
(R):5'- GTGGGGTTTGACTTCAATGTATTGAC -3'
Posted On 2020-09-02