Incidental Mutation 'R8328:Wdr19'
ID 644195
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene Name WD repeat domain 19
Synonyms D330023L08Rik, DYF2, C330027H04Rik, Ift144
MMRRC Submission 067727-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 65357039-65417758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65382638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 454 (E454G)
Ref Sequence ENSEMBL: ENSMUSP00000038098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
AlphaFold Q3UGF1
Predicted Effect probably damaging
Transcript: ENSMUST00000041892
AA Change: E454G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: E454G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203653
AA Change: E454G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: E454G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,866,993 (GRCm39) M682K probably benign Het
Ankdd1b T A 13: 96,591,374 (GRCm39) I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 (GRCm39) E489K probably benign Het
Arhgef28 A T 13: 98,187,517 (GRCm39) H259Q possibly damaging Het
Atosb T C 4: 43,034,751 (GRCm39) T323A probably benign Het
C3 T C 17: 57,527,973 (GRCm39) S749G probably benign Het
Celsr1 A G 15: 85,806,445 (GRCm39) S2338P probably benign Het
Ces2a A T 8: 105,463,998 (GRCm39) N210I probably damaging Het
Cuzd1 A T 7: 130,913,345 (GRCm39) V424D probably damaging Het
Cyp2j11 T A 4: 96,236,605 (GRCm39) H67L probably benign Het
Dennd5b A G 6: 148,922,115 (GRCm39) S800P probably damaging Het
Dmrta2 G T 4: 109,837,206 (GRCm39) L49F unknown Het
Dpy19l1 T A 9: 24,386,686 (GRCm39) K9* probably null Het
Dsc2 T C 18: 20,165,576 (GRCm39) H843R possibly damaging Het
Dsg1b T A 18: 20,510,007 (GRCm39) F6I probably benign Het
Hck C T 2: 152,970,987 (GRCm39) A83V probably damaging Het
Hdc T C 2: 126,443,803 (GRCm39) E292G probably damaging Het
Ighv1-23 A G 12: 114,728,116 (GRCm39) L102P probably damaging Het
Kdm3b G A 18: 34,926,123 (GRCm39) V88M probably damaging Het
Kremen2 A G 17: 23,961,745 (GRCm39) V254A probably benign Het
Lrrc8e T A 8: 4,285,641 (GRCm39) I622N probably damaging Het
Megf8 A G 7: 25,046,917 (GRCm39) N1600S probably benign Het
Mical3 A G 6: 120,912,138 (GRCm39) I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 (GRCm39) Y26N probably damaging Het
Nrl T C 14: 55,758,163 (GRCm39) E188G probably damaging Het
Or4d1 A G 11: 87,804,985 (GRCm39) M249T possibly damaging Het
Or9e1 T A 11: 58,732,460 (GRCm39) D173E probably benign Het
Polr1a G A 6: 71,897,718 (GRCm39) E238K probably benign Het
Pramel26 A G 4: 143,537,380 (GRCm39) L317P probably damaging Het
Prr5 G C 15: 84,587,387 (GRCm39) *388S probably null Het
Rptor A G 11: 119,783,473 (GRCm39) T1156A probably benign Het
Slc9c1 T A 16: 45,398,227 (GRCm39) I664K probably damaging Het
Stn1 C A 19: 47,505,498 (GRCm39) R152L probably damaging Het
Syde2 T C 3: 145,721,496 (GRCm39) V1121A probably benign Het
Vmn1r158 T C 7: 22,489,487 (GRCm39) T241A probably damaging Het
Vmn1r209 C A 13: 22,990,643 (GRCm39) V16L probably benign Het
Zan C T 5: 137,392,726 (GRCm39) E4590K unknown Het
Zfp579 T G 7: 4,997,866 (GRCm39) H15P unknown Het
Zfp628 A G 7: 4,922,813 (GRCm39) N345S probably benign Het
Zfp944 T A 17: 22,558,705 (GRCm39) K181* probably null Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65,409,642 (GRCm39) missense probably benign 0.41
IGL01346:Wdr19 APN 5 65,379,082 (GRCm39) splice site probably benign
IGL01761:Wdr19 APN 5 65,373,163 (GRCm39) missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65,382,709 (GRCm39) missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65,385,912 (GRCm39) missense probably benign
IGL02314:Wdr19 APN 5 65,414,463 (GRCm39) missense probably benign 0.26
IGL02455:Wdr19 APN 5 65,382,102 (GRCm39) missense probably benign 0.01
IGL02542:Wdr19 APN 5 65,388,414 (GRCm39) missense probably benign
IGL02616:Wdr19 APN 5 65,380,924 (GRCm39) missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65,403,151 (GRCm39) missense probably benign 0.06
IGL02927:Wdr19 APN 5 65,409,721 (GRCm39) missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65,370,150 (GRCm39) splice site probably null
IGL03083:Wdr19 APN 5 65,388,319 (GRCm39) missense probably benign 0.01
IGL03332:Wdr19 APN 5 65,384,486 (GRCm39) missense possibly damaging 0.89
detritus UTSW 5 65,370,234 (GRCm39) missense possibly damaging 0.59
R4609_Wdr19_503 UTSW 5 65,385,885 (GRCm39) missense possibly damaging 0.83
R7190_Wdr19_539 UTSW 5 65,398,205 (GRCm39) missense probably benign 0.35
refuse UTSW 5 65,385,635 (GRCm39) missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65,413,782 (GRCm39) splice site probably benign
R1178:Wdr19 UTSW 5 65,381,208 (GRCm39) missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65,413,734 (GRCm39) missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65,380,847 (GRCm39) splice site probably benign
R1543:Wdr19 UTSW 5 65,382,033 (GRCm39) missense probably benign 0.06
R1819:Wdr19 UTSW 5 65,370,234 (GRCm39) missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65,398,503 (GRCm39) splice site probably benign
R2190:Wdr19 UTSW 5 65,401,509 (GRCm39) missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65,398,334 (GRCm39) missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65,359,966 (GRCm39) missense probably benign 0.20
R3753:Wdr19 UTSW 5 65,382,069 (GRCm39) missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65,385,635 (GRCm39) missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65,385,885 (GRCm39) missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65,382,752 (GRCm39) missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65,401,522 (GRCm39) missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65,385,562 (GRCm39) missense probably benign
R5837:Wdr19 UTSW 5 65,360,300 (GRCm39) missense probably benign 0.08
R5902:Wdr19 UTSW 5 65,384,482 (GRCm39) missense probably benign 0.09
R6065:Wdr19 UTSW 5 65,379,056 (GRCm39) missense probably benign
R6419:Wdr19 UTSW 5 65,373,236 (GRCm39) missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65,415,466 (GRCm39) missense probably benign 0.00
R6916:Wdr19 UTSW 5 65,382,677 (GRCm39) missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65,413,657 (GRCm39) missense probably damaging 0.99
R7190:Wdr19 UTSW 5 65,398,205 (GRCm39) missense probably benign 0.35
R7972:Wdr19 UTSW 5 65,381,193 (GRCm39) missense probably damaging 1.00
R8390:Wdr19 UTSW 5 65,381,210 (GRCm39) nonsense probably null
R8960:Wdr19 UTSW 5 65,398,211 (GRCm39) missense probably benign
R9260:Wdr19 UTSW 5 65,363,789 (GRCm39) missense possibly damaging 0.90
X0028:Wdr19 UTSW 5 65,401,487 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCTGCACATAAACCTCC -3'
(R):5'- AAATGGCCAGTCACTTCTTCATTTG -3'

Sequencing Primer
(F):5'- TCCCACTAAATAAAGGATGCTCGTGG -3'
(R):5'- GGCCAGTCACTTCTTCATTTGTATTG -3'
Posted On 2020-09-02