Incidental Mutation 'R8328:Wdr19'
ID 644195
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene Name WD repeat domain 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 65199696-65260415 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65225295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 454 (E454G)
Ref Sequence ENSEMBL: ENSMUSP00000038098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
AlphaFold Q3UGF1
Predicted Effect probably damaging
Transcript: ENSMUST00000041892
AA Change: E454G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: E454G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203653
AA Change: E454G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: E454G

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65252299 missense probably benign 0.41
IGL01346:Wdr19 APN 5 65221739 splice site probably benign
IGL01761:Wdr19 APN 5 65215820 missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65225366 missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65228569 missense probably benign
IGL02314:Wdr19 APN 5 65257120 missense probably benign 0.26
IGL02455:Wdr19 APN 5 65224759 missense probably benign 0.01
IGL02542:Wdr19 APN 5 65231071 missense probably benign
IGL02616:Wdr19 APN 5 65223581 missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65245808 missense probably benign 0.06
IGL02927:Wdr19 APN 5 65252378 missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65212807 splice site probably null
IGL03083:Wdr19 APN 5 65230976 missense probably benign 0.01
IGL03332:Wdr19 APN 5 65227143 missense possibly damaging 0.89
detritus UTSW 5 65212891 missense possibly damaging 0.59
R4609_Wdr19_503 UTSW 5 65228542 missense possibly damaging 0.83
R7190_Wdr19_539 UTSW 5 65240862 missense probably benign 0.35
refuse UTSW 5 65228292 missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65256439 splice site probably benign
R1178:Wdr19 UTSW 5 65223865 missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65256391 missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65223504 splice site probably benign
R1543:Wdr19 UTSW 5 65224690 missense probably benign 0.06
R1819:Wdr19 UTSW 5 65212891 missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65241160 splice site probably benign
R2190:Wdr19 UTSW 5 65244166 missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65240991 missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65202623 missense probably benign 0.20
R3753:Wdr19 UTSW 5 65224726 missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65228292 missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65228542 missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65225409 missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65244179 missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65228219 missense probably benign
R5837:Wdr19 UTSW 5 65202957 missense probably benign 0.08
R5902:Wdr19 UTSW 5 65227139 missense probably benign 0.09
R6065:Wdr19 UTSW 5 65221713 missense probably benign
R6419:Wdr19 UTSW 5 65215893 missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65258123 missense probably benign 0.00
R6916:Wdr19 UTSW 5 65225334 missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65256314 missense probably damaging 0.99
R7190:Wdr19 UTSW 5 65240862 missense probably benign 0.35
R7972:Wdr19 UTSW 5 65223850 missense probably damaging 1.00
R8390:Wdr19 UTSW 5 65223867 nonsense probably null
R8960:Wdr19 UTSW 5 65240868 missense probably benign
R9260:Wdr19 UTSW 5 65206446 missense possibly damaging 0.90
X0028:Wdr19 UTSW 5 65244144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCTGCACATAAACCTCC -3'
(R):5'- AAATGGCCAGTCACTTCTTCATTTG -3'

Sequencing Primer
(F):5'- TCCCACTAAATAAAGGATGCTCGTGG -3'
(R):5'- GGCCAGTCACTTCTTCATTTGTATTG -3'
Posted On 2020-09-02