Incidental Mutation 'R8328:Zfp579'
ID644202
Institutional Source Beutler Lab
Gene Symbol Zfp579
Ensembl Gene ENSMUSG00000051550
Gene Namezinc finger protein 579
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8328 (G1)
Quality Score195.009
Status Not validated
Chromosome7
Chromosomal Location4983483-4996158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4994867 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 15 (H15P)
Ref Sequence ENSEMBL: ENSMUSP00000104212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108572] [ENSMUST00000162502] [ENSMUST00000162731]
Predicted Effect unknown
Transcript: ENSMUST00000108572
AA Change: H15P
SMART Domains Protein: ENSMUSP00000104212
Gene: ENSMUSG00000051550
AA Change: H15P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162502
AA Change: H15P
SMART Domains Protein: ENSMUSP00000124074
Gene: ENSMUSG00000051550
AA Change: H15P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
coiled coil region 190 213 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162731
AA Change: H15P
SMART Domains Protein: ENSMUSP00000123963
Gene: ENSMUSG00000051550
AA Change: H15P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Zfp579
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Zfp579 APN 7 4993391 missense probably damaging 0.97
IGL01121:Zfp579 APN 7 4993247 missense possibly damaging 0.59
IGL01475:Zfp579 APN 7 4994744 missense probably benign 0.32
IGL01866:Zfp579 APN 7 4994258 missense possibly damaging 0.88
IGL02284:Zfp579 APN 7 4994168 missense probably damaging 0.99
IGL02313:Zfp579 APN 7 4994433 missense probably benign 0.23
R1803:Zfp579 UTSW 7 4993770 missense probably damaging 1.00
R2025:Zfp579 UTSW 7 4993521 nonsense probably null
R2026:Zfp579 UTSW 7 4993521 nonsense probably null
R2027:Zfp579 UTSW 7 4993521 nonsense probably null
R3690:Zfp579 UTSW 7 4994720 missense probably damaging 0.99
R4303:Zfp579 UTSW 7 4993073 utr 3 prime probably benign
R6680:Zfp579 UTSW 7 4993502 missense probably damaging 0.99
R6826:Zfp579 UTSW 7 4994426 missense probably benign 0.01
R6869:Zfp579 UTSW 7 4994461 missense probably benign 0.00
R7304:Zfp579 UTSW 7 4994583 missense probably benign 0.22
R8220:Zfp579 UTSW 7 4993851 missense probably benign 0.15
X0028:Zfp579 UTSW 7 4993933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGACCCGAGTGGCTCA -3'
(R):5'- GTTTCTCCTGAACTTGGCCC -3'

Sequencing Primer
(F):5'- TCAGCCGGTGTCGAGACAG -3'
(R):5'- ACGTCTCCACAACTCTCTCC -3'
Posted On2020-09-02