Incidental Mutation 'R8328:Zscan5b'
ID644203
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Namezinc finger and SCAN domain containing 5B
SynonymsZfg1, Zfp371
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6222278-6239423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6233947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 232 (P232S)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6231422 missense probably benign 0.00
R0505:Zscan5b UTSW 7 6239075 missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6233912 missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6230426 missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6233851 missense probably benign 0.00
R1613:Zscan5b UTSW 7 6230375 missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6239163 missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6238966 missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6231443 missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6239190 makesense probably null
R5624:Zscan5b UTSW 7 6230519 missense probably benign 0.00
R8213:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
X0018:Zscan5b UTSW 7 6230276 missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6238949 missense probably benign 0.00
X0025:Zscan5b UTSW 7 6238615 missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6230217 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCGATCCAGACAGCTTTCTG -3'
(R):5'- GCTGCAATTCGGGTATAAAGTG -3'

Sequencing Primer
(F):5'- TCCATCTCTCCGTGGAACAAAC -3'
(R):5'- TCAACTCTGGTGTTGGCT -3'
Posted On2020-09-02