Incidental Mutation 'R8328:Lrrc8e'
ID644207
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Nameleucine rich repeat containing 8 family, member E
Synonyms1810049O03Rik, C87354
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location4226827-4237470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4235641 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 622 (I622N)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: I622N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: I622N

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4235921 missense probably benign
IGL00943:Lrrc8e APN 8 4235658 missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4235080 missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4234084 missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4236141 missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4235392 missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4235429 missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4235776 missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4235733 missense probably benign
R0601:Lrrc8e UTSW 8 4235239 splice site probably null
R1167:Lrrc8e UTSW 8 4235337 missense probably benign
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4234990 missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4234190 missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4235202 missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4234986 nonsense probably null
R2290:Lrrc8e UTSW 8 4231770 missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4234611 missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4233981 missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4235166 missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4234329 missense probably benign
R5516:Lrrc8e UTSW 8 4235818 missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4235725 missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4234798 missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4236034 missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4234815 missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4235626 missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4234363 missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4234534 missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4235575 missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4235140 missense probably damaging 0.99
Z1176:Lrrc8e UTSW 8 4234822 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGCCTGCACAATGATGGG -3'
(R):5'- ACTCTCGAGTGCGTTGTAGGAG -3'

Sequencing Primer
(F):5'- TGCACAATGATGGGGCTCG -3'
(R):5'- TCTGGAGAAGGCCCAACTCAG -3'
Posted On2020-09-02