Incidental Mutation 'R8328:Dpy19l1'
ID644209
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Namedpy-19-like 1 (C. elegans)
Synonyms1100001I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location24411776-24503140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24475390 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 9 (K9*)
Ref Sequence ENSEMBL: ENSMUSP00000110932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
Predicted Effect probably null
Transcript: ENSMUST00000115277
AA Change: K9*
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067
AA Change: K9*

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142064
AA Change: K203*
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: K203*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170356
AA Change: K203*
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: K203*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24481930 missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24462568 splice site probably benign
IGL00959:Dpy19l1 APN 9 24423197 splice site probably null
IGL01646:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24475386 missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24438713 splice site probably benign
IGL02677:Dpy19l1 APN 9 24485072 missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24421180 missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24438660 missense probably benign 0.00
R0066:Dpy19l1 UTSW 9 24414409 missense possibly damaging 0.95
R0207:Dpy19l1 UTSW 9 24453891 missense probably damaging 1.00
R0462:Dpy19l1 UTSW 9 24414349 missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24485110 splice site probably benign
R0749:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R0838:Dpy19l1 UTSW 9 24432431 missense probably damaging 0.98
R1114:Dpy19l1 UTSW 9 24424776 missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24475384 missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24473824 missense probably benign
R1933:Dpy19l1 UTSW 9 24434387 missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24423159 missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24482035 missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24485048 missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24432388 missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4653:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24432368 missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24450670 missense probably benign 0.29
R4769:Dpy19l1 UTSW 9 24426148 missense probably damaging 0.99
R4785:Dpy19l1 UTSW 9 24424823 missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24438628 critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24414388 missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24414267 makesense probably null
R6265:Dpy19l1 UTSW 9 24432371 missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24439146 missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24462600 missense probably damaging 1.00
R6380:Dpy19l1 UTSW 9 24482045 nonsense probably null
R6478:Dpy19l1 UTSW 9 24450696 missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24447864 missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24473784 missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24440772 missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24423123 missense possibly damaging 0.88
R7862:Dpy19l1 UTSW 9 24475434 missense probably damaging 1.00
R7921:Dpy19l1 UTSW 9 24422338 missense possibly damaging 0.85
R8095:Dpy19l1 UTSW 9 24484864 splice site probably null
R8192:Dpy19l1 UTSW 9 24450727 missense possibly damaging 0.75
R8248:Dpy19l1 UTSW 9 24502895 missense probably benign
R8296:Dpy19l1 UTSW 9 24503076 missense probably benign 0.00
R8307:Dpy19l1 UTSW 9 24503001 missense probably benign
X0025:Dpy19l1 UTSW 9 24432380 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCCCAAAATTGAGACTTGC -3'
(R):5'- GAGAGGCTGAGCTTCGTTTAAC -3'

Sequencing Primer
(F):5'- TTGAGACTTGCAAAATCCAAAAGC -3'
(R):5'- TGGAATTCACTCTAGACCAGGCTG -3'
Posted On2020-09-02