Mutagenetix > Incidental Mutation

Incidental Mutation 'R8328:Rptor'

644212

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

Rap, raptor, 4932417H02Rik

MMRRC Submission

067727-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119493731-119790402 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119783473 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1156 (T1156A)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026671
AA Change: T1156A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: T1156A

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136662

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	T	6: 92,866,993 (GRCm39)	M682K	probably benign	Het
Ankdd1b	T	A	13: 96,591,374 (GRCm39)	I42F	possibly damaging	Het
Ankrd6	C	T	4: 32,810,215 (GRCm39)	E489K	probably benign	Het
Arhgef28	A	T	13: 98,187,517 (GRCm39)	H259Q	possibly damaging	Het
Atosb	T	C	4: 43,034,751 (GRCm39)	T323A	probably benign	Het
C3	T	C	17: 57,527,973 (GRCm39)	S749G	probably benign	Het
Celsr1	A	G	15: 85,806,445 (GRCm39)	S2338P	probably benign	Het
Ces2a	A	T	8: 105,463,998 (GRCm39)	N210I	probably damaging	Het
Cuzd1	A	T	7: 130,913,345 (GRCm39)	V424D	probably damaging	Het
Cyp2j11	T	A	4: 96,236,605 (GRCm39)	H67L	probably benign	Het
Dennd5b	A	G	6: 148,922,115 (GRCm39)	S800P	probably damaging	Het
Dmrta2	G	T	4: 109,837,206 (GRCm39)	L49F	unknown	Het
Dpy19l1	T	A	9: 24,386,686 (GRCm39)	K9*	probably null	Het
Dsc2	T	C	18: 20,165,576 (GRCm39)	H843R	possibly damaging	Het
Dsg1b	T	A	18: 20,510,007 (GRCm39)	F6I	probably benign	Het
Hck	C	T	2: 152,970,987 (GRCm39)	A83V	probably damaging	Het
Hdc	T	C	2: 126,443,803 (GRCm39)	E292G	probably damaging	Het
Ighv1-23	A	G	12: 114,728,116 (GRCm39)	L102P	probably damaging	Het
Kdm3b	G	A	18: 34,926,123 (GRCm39)	V88M	probably damaging	Het
Kremen2	A	G	17: 23,961,745 (GRCm39)	V254A	probably benign	Het
Lrrc8e	T	A	8: 4,285,641 (GRCm39)	I622N	probably damaging	Het
Megf8	A	G	7: 25,046,917 (GRCm39)	N1600S	probably benign	Het
Mical3	A	G	6: 120,912,138 (GRCm39)	I1907T	probably damaging	Het
Nr4a3	T	A	4: 48,051,323 (GRCm39)	Y26N	probably damaging	Het
Nrl	T	C	14: 55,758,163 (GRCm39)	E188G	probably damaging	Het
Or4d1	A	G	11: 87,804,985 (GRCm39)	M249T	possibly damaging	Het
Or9e1	T	A	11: 58,732,460 (GRCm39)	D173E	probably benign	Het
Polr1a	G	A	6: 71,897,718 (GRCm39)	E238K	probably benign	Het
Pramel26	A	G	4: 143,537,380 (GRCm39)	L317P	probably damaging	Het
Prr5	G	C	15: 84,587,387 (GRCm39)	*388S	probably null	Het
Slc9c1	T	A	16: 45,398,227 (GRCm39)	I664K	probably damaging	Het
Stn1	C	A	19: 47,505,498 (GRCm39)	R152L	probably damaging	Het
Syde2	T	C	3: 145,721,496 (GRCm39)	V1121A	probably benign	Het
Vmn1r158	T	C	7: 22,489,487 (GRCm39)	T241A	probably damaging	Het
Vmn1r209	C	A	13: 22,990,643 (GRCm39)	V16L	probably benign	Het
Wdr19	A	G	5: 65,382,638 (GRCm39)	E454G	probably damaging	Het
Zan	C	T	5: 137,392,726 (GRCm39)	E4590K	unknown	Het
Zfp579	T	G	7: 4,997,866 (GRCm39)	H15P	unknown	Het
Zfp628	A	G	7: 4,922,813 (GRCm39)	N345S	probably benign	Het
Zfp944	T	A	17: 22,558,705 (GRCm39)	K181*	probably null	Het
Zscan5b	C	T	7: 6,236,946 (GRCm39)	P232S	possibly damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119,690,271 (GRCm39)	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119,781,996 (GRCm39)	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119,787,262 (GRCm39)	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119,748,279 (GRCm39)	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119,548,500 (GRCm39)	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119,737,741 (GRCm39)	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119,671,413 (GRCm39)	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119,783,438 (GRCm39)	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119,615,971 (GRCm39)	missense	probably damaging	1.00
Velocipede	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119,775,793 (GRCm39)	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119,763,193 (GRCm39)	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119,785,738 (GRCm39)	splice site	probably benign
R0219:Rptor	UTSW	11	119,712,603 (GRCm39)	intron	probably benign
R0324:Rptor	UTSW	11	119,783,467 (GRCm39)	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119,671,379 (GRCm39)	nonsense	probably null
R0718:Rptor	UTSW	11	119,763,202 (GRCm39)	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119,775,780 (GRCm39)	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119,734,569 (GRCm39)	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119,634,717 (GRCm39)	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119,671,419 (GRCm39)	nonsense	probably null
R1579:Rptor	UTSW	11	119,786,827 (GRCm39)	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119,615,887 (GRCm39)	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119,647,146 (GRCm39)	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119,615,970 (GRCm39)	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2275:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2408:Rptor	UTSW	11	119,748,277 (GRCm39)	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119,756,420 (GRCm39)	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119,747,124 (GRCm39)	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119,562,171 (GRCm39)	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119,689,666 (GRCm39)	missense	probably null	1.00
R4647:Rptor	UTSW	11	119,781,989 (GRCm39)	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119,634,708 (GRCm39)	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119,748,217 (GRCm39)	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119,712,466 (GRCm39)	intron	probably benign
R5073:Rptor	UTSW	11	119,787,305 (GRCm39)	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119,494,642 (GRCm39)	missense	probably benign
R5216:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119,713,782 (GRCm39)	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119,647,075 (GRCm39)	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119,788,268 (GRCm39)	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119,786,838 (GRCm39)	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119,647,171 (GRCm39)	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119,737,762 (GRCm39)	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119,765,012 (GRCm39)	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119,763,181 (GRCm39)	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119,775,805 (GRCm39)	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119,634,779 (GRCm39)	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119,783,453 (GRCm39)	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119,748,779 (GRCm39)	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119,748,763 (GRCm39)	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119,702,812 (GRCm39)	missense	probably damaging	1.00
R8351:Rptor	UTSW	11	119,783,465 (GRCm39)	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119,615,858 (GRCm39)	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119,494,751 (GRCm39)	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119,734,508 (GRCm39)	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119,777,896 (GRCm39)	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119,494,765 (GRCm39)	missense	probably benign
R9224:Rptor	UTSW	11	119,785,113 (GRCm39)	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119,702,823 (GRCm39)	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119,786,772 (GRCm39)	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119,562,152 (GRCm39)	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119,781,940 (GRCm39)	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119,777,964 (GRCm39)	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119,737,231 (GRCm39)	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119,748,692 (GRCm39)	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119,762,318 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,748,279 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,742,294 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,737,578 (GRCm39)	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119,690,145 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,647,241 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,647,062 (GRCm39)	splice site	probably null
Z0001:Rptor	UTSW	11	119,494,798 (GRCm39)	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119,787,375 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,764,977 (GRCm39)	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTAACCCAGCCGTACATGAG -3'
(R):5'- CAGGGTCAAAGTGCCACAATC -3'

Sequencing Primer
(F):5'- CCAGCCGTACATGAGTGAGG -3'
(R):5'- ACAATCAGTGTGTACCCAGG -3'

Posted On

2020-09-02