Incidental Mutation 'R8328:Ighv1-23'
ID644213
Institutional Source Beutler Lab
Gene Symbol Ighv1-23
Ensembl Gene ENSMUSG00000103290
Gene Nameimmunoglobulin heavy variable V1-23
SynonymsIghv1-23, immunoglobulin heavy variable V1-23
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R8328 (G1)
Quality Score160.009
Status Not validated
Chromosome12
Chromosomal Location114764450-114764883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114764496 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 102 (L102P)
Ref Sequence ENSEMBL: ENSMUSP00000141293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000194625]
Predicted Effect probably damaging
Transcript: ENSMUST00000194625
AA Change: L102P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141293
Gene: ENSMUSG00000103290
AA Change: L102P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 4.5e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ighv1-23
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3413:Ighv1-23 UTSW 12 114764467 missense probably benign 0.10
R3414:Ighv1-23 UTSW 12 114764467 missense probably benign 0.10
R4602:Ighv1-23 UTSW 12 114764559 missense probably benign 0.27
R4911:Ighv1-23 UTSW 12 114764752 missense possibly damaging 0.81
R5347:Ighv1-23 UTSW 12 114764756 critical splice acceptor site probably benign
R6603:Ighv1-23 UTSW 12 114764521 missense probably damaging 1.00
R7438:Ighv1-23 UTSW 12 114764475 missense probably damaging 1.00
R7771:Ighv1-23 UTSW 12 114764736 missense probably benign 0.25
Z1177:Ighv1-23 UTSW 12 114764685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTACAAAGGTGACAAAGGCAC -3'
(R):5'- GCTTCGGGCTACACATTTACTG -3'

Sequencing Primer
(F):5'- TGACAAAGGCACTATAGGACAGC -3'
(R):5'- CGGGCTACACATTTACTGACTATG -3'
Posted On2020-09-02