Incidental Mutation 'R8328:Ankdd1b'
ID644215
Institutional Source Beutler Lab
Gene Symbol Ankdd1b
Ensembl Gene ENSMUSG00000047117
Gene Nameankyrin repeat and death domain containing 1B
Synonyms9330128J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96416134-96471198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96454866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 42 (I42F)
Ref Sequence ENSEMBL: ENSMUSP00000061643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055607
AA Change: I42F

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061643
Gene: ENSMUSG00000047117
AA Change: I42F

DomainStartEndE-ValueType
ANK 4 33 2.54e-2 SMART
ANK 37 66 6.36e-3 SMART
ANK 70 101 5.09e-2 SMART
ANK 105 137 1.07e0 SMART
ANK 138 167 1.27e-2 SMART
ANK 171 200 3.65e-3 SMART
ANK 204 233 2.99e1 SMART
ANK 237 266 4.07e-1 SMART
ANK 270 299 6.92e-4 SMART
ANK 303 335 1.76e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ankdd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ankdd1b APN 13 96417830 unclassified probably benign
IGL00849:Ankdd1b APN 13 96420733 missense probably damaging 1.00
IGL02805:Ankdd1b APN 13 96444302 missense probably benign
IGL02980:Ankdd1b UTSW 13 96435940 missense probably benign 0.01
R1454:Ankdd1b UTSW 13 96433405 splice site probably null
R1730:Ankdd1b UTSW 13 96460903 missense probably damaging 0.99
R1759:Ankdd1b UTSW 13 96419703 missense probably damaging 1.00
R4716:Ankdd1b UTSW 13 96454583 nonsense probably null
R4719:Ankdd1b UTSW 13 96417747 unclassified probably benign
R5262:Ankdd1b UTSW 13 96420773 missense probably damaging 1.00
R6329:Ankdd1b UTSW 13 96454880 missense possibly damaging 0.76
R6418:Ankdd1b UTSW 13 96460897 missense probably damaging 1.00
R6869:Ankdd1b UTSW 13 96444291 missense possibly damaging 0.77
R7126:Ankdd1b UTSW 13 96429862 missense possibly damaging 0.93
R7442:Ankdd1b UTSW 13 96424760 missense possibly damaging 0.77
R7840:Ankdd1b UTSW 13 96419798 critical splice acceptor site probably null
R7921:Ankdd1b UTSW 13 96424780 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGGAGAGCGTTCATTCCTTC -3'
(R):5'- CTTCCATAGAACTGCAATATCGC -3'

Sequencing Primer
(F):5'- CATTCCTTCCTGAAGAGAGTCAGAG -3'
(R):5'- CCATAGAACTGCAATATCGCTTTTG -3'
Posted On2020-09-02