Incidental Mutation 'R8328:Prr5'
ID644218
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Nameproline rich 5 (renal)
SynonymsC030017C09Rik, Protor-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location84669620-84703673 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) G to C at 84703186 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Serine at position 388 (*388S)
Ref Sequence ENSEMBL: ENSMUSP00000066396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
Predicted Effect probably null
Transcript: ENSMUST00000065499
AA Change: *388S
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: *388S

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171460
AA Change: *379S
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: *379S

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84699655 missense possibly damaging 0.47
IGL02656:Prr5 APN 15 84699136 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0389:Prr5 UTSW 15 84702951 missense probably benign 0.00
R0514:Prr5 UTSW 15 84702766 missense probably benign 0.19
R1414:Prr5 UTSW 15 84699711 nonsense probably null
R2027:Prr5 UTSW 15 84701379 missense probably damaging 0.99
R2230:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2231:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2232:Prr5 UTSW 15 84702780 missense probably benign 0.15
R3498:Prr5 UTSW 15 84703144 missense probably benign 0.12
R3791:Prr5 UTSW 15 84681216 missense probably damaging 1.00
R3910:Prr5 UTSW 15 84703144 missense probably benign 0.12
R5514:Prr5 UTSW 15 84702895 missense probably benign 0.01
R5911:Prr5 UTSW 15 84701434 nonsense probably null
R6085:Prr5 UTSW 15 84687905 missense probably damaging 1.00
R6187:Prr5 UTSW 15 84693772 missense probably damaging 1.00
R6394:Prr5 UTSW 15 84699724 missense probably damaging 0.99
R6422:Prr5 UTSW 15 84693804 missense probably damaging 1.00
R6631:Prr5 UTSW 15 84702777 missense probably damaging 0.99
R8113:Prr5 UTSW 15 84693792 missense probably damaging 1.00
R8268:Prr5 UTSW 15 84702991 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAGATGACATCTTGTCCGGAG -3'
(R):5'- AAGTGACTTGAGGCAGTGAC -3'

Sequencing Primer
(F):5'- AGGGCTTTGTGGACACGC -3'
(R):5'- CTTGAGGCAGTGACGGGGG -3'
Posted On2020-09-02