Incidental Mutation 'R8328:Zfp944'
ID644221
Institutional Source Beutler Lab
Gene Symbol Zfp944
Ensembl Gene ENSMUSG00000033972
Gene Namezinc finger protein 944
Synonyms6330416L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22337989-22361400 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22339724 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 181 (K181*)
Ref Sequence ENSEMBL: ENSMUSP00000111197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115535]
Predicted Effect probably null
Transcript: ENSMUST00000115535
AA Change: K181*
SMART Domains Protein: ENSMUSP00000111197
Gene: ENSMUSG00000033972
AA Change: K181*

DomainStartEndE-ValueType
KRAB 13 76 2.08e-21 SMART
ZnF_C2H2 183 205 1.01e-1 SMART
ZnF_C2H2 211 233 1.07e0 SMART
ZnF_C2H2 239 261 1.95e-3 SMART
ZnF_C2H2 267 289 1.22e-4 SMART
ZnF_C2H2 295 317 2.24e-3 SMART
ZnF_C2H2 323 345 1.82e-3 SMART
ZnF_C2H2 351 373 5.99e-4 SMART
ZnF_C2H2 379 401 4.79e-3 SMART
ZnF_C2H2 407 429 2.99e-4 SMART
ZnF_C2H2 435 457 4.17e-3 SMART
ZnF_C2H2 463 485 1.36e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Zfp944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Zfp944 APN 17 22339205 missense probably benign 0.10
IGL00917:Zfp944 APN 17 22339784 missense probably benign 0.00
IGL01093:Zfp944 APN 17 22343634 splice site probably benign
IGL02113:Zfp944 APN 17 22339066 missense possibly damaging 0.88
IGL02694:Zfp944 APN 17 22339918 missense probably benign 0.05
IGL03135:Zfp944 APN 17 22339756 missense probably benign 0.00
IGL03172:Zfp944 APN 17 22340037 missense probably damaging 0.98
R0121:Zfp944 UTSW 17 22339268 missense possibly damaging 0.69
R0336:Zfp944 UTSW 17 22339028 missense probably damaging 1.00
R0755:Zfp944 UTSW 17 22339908 missense possibly damaging 0.63
R1536:Zfp944 UTSW 17 22339716 nonsense probably null
R1708:Zfp944 UTSW 17 22339045 missense probably damaging 0.98
R1886:Zfp944 UTSW 17 22339979 missense probably benign 0.04
R1928:Zfp944 UTSW 17 22341084 missense probably damaging 0.96
R1950:Zfp944 UTSW 17 22339700 missense probably benign 0.16
R2075:Zfp944 UTSW 17 22339197 nonsense probably null
R2101:Zfp944 UTSW 17 22339828 missense probably benign 0.41
R2433:Zfp944 UTSW 17 22339212 nonsense probably null
R4698:Zfp944 UTSW 17 22339199 missense probably damaging 1.00
R4986:Zfp944 UTSW 17 22339230 missense probably damaging 1.00
R6451:Zfp944 UTSW 17 22338865 missense probably benign 0.40
R6566:Zfp944 UTSW 17 22339745 missense possibly damaging 0.96
R6752:Zfp944 UTSW 17 22339519 missense probably benign 0.01
R7064:Zfp944 UTSW 17 22339579 missense probably damaging 1.00
R8193:Zfp944 UTSW 17 22339880 nonsense probably null
R8323:Zfp944 UTSW 17 22339254 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACATTTGTAAGGTTTCTCTCCTG -3'
(R):5'- GGGATACACATGTTAAGTCATCAGATG -3'

Sequencing Primer
(F):5'- AAGGTTTCTCTCCTGTATGAATTTTC -3'
(R):5'- TCAGATGTAAACAGACATGAAACTG -3'
Posted On2020-09-02