Incidental Mutation 'R8328:Zfp944'
ID 644221
Institutional Source Beutler Lab
Gene Symbol Zfp944
Ensembl Gene ENSMUSG00000033972
Gene Name zinc finger protein 944
Synonyms 6330416L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R8328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22337989-22361400 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 22339724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 181 (K181*)
Ref Sequence ENSEMBL: ENSMUSP00000111197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115535]
AlphaFold E9PUS4
Predicted Effect probably null
Transcript: ENSMUST00000115535
AA Change: K181*
SMART Domains Protein: ENSMUSP00000111197
Gene: ENSMUSG00000033972
AA Change: K181*

DomainStartEndE-ValueType
KRAB 13 76 2.08e-21 SMART
ZnF_C2H2 183 205 1.01e-1 SMART
ZnF_C2H2 211 233 1.07e0 SMART
ZnF_C2H2 239 261 1.95e-3 SMART
ZnF_C2H2 267 289 1.22e-4 SMART
ZnF_C2H2 295 317 2.24e-3 SMART
ZnF_C2H2 323 345 1.82e-3 SMART
ZnF_C2H2 351 373 5.99e-4 SMART
ZnF_C2H2 379 401 4.79e-3 SMART
ZnF_C2H2 407 429 2.99e-4 SMART
ZnF_C2H2 435 457 4.17e-3 SMART
ZnF_C2H2 463 485 1.36e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Zfp944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Zfp944 APN 17 22339205 missense probably benign 0.10
IGL00917:Zfp944 APN 17 22339784 missense probably benign 0.00
IGL01093:Zfp944 APN 17 22343634 splice site probably benign
IGL02113:Zfp944 APN 17 22339066 missense possibly damaging 0.88
IGL02694:Zfp944 APN 17 22339918 missense probably benign 0.05
IGL03135:Zfp944 APN 17 22339756 missense probably benign 0.00
IGL03172:Zfp944 APN 17 22340037 missense probably damaging 0.98
R0121:Zfp944 UTSW 17 22339268 missense possibly damaging 0.69
R0336:Zfp944 UTSW 17 22339028 missense probably damaging 1.00
R0755:Zfp944 UTSW 17 22339908 missense possibly damaging 0.63
R1536:Zfp944 UTSW 17 22339716 nonsense probably null
R1708:Zfp944 UTSW 17 22339045 missense probably damaging 0.98
R1886:Zfp944 UTSW 17 22339979 missense probably benign 0.04
R1928:Zfp944 UTSW 17 22341084 missense probably damaging 0.96
R1950:Zfp944 UTSW 17 22339700 missense probably benign 0.16
R2075:Zfp944 UTSW 17 22339197 nonsense probably null
R2101:Zfp944 UTSW 17 22339828 missense probably benign 0.41
R2433:Zfp944 UTSW 17 22339212 nonsense probably null
R4698:Zfp944 UTSW 17 22339199 missense probably damaging 1.00
R4986:Zfp944 UTSW 17 22339230 missense probably damaging 1.00
R6451:Zfp944 UTSW 17 22338865 missense probably benign 0.40
R6566:Zfp944 UTSW 17 22339745 missense possibly damaging 0.96
R6752:Zfp944 UTSW 17 22339519 missense probably benign 0.01
R7064:Zfp944 UTSW 17 22339579 missense probably damaging 1.00
R8193:Zfp944 UTSW 17 22339880 nonsense probably null
R8323:Zfp944 UTSW 17 22339254 missense probably benign
R8902:Zfp944 UTSW 17 22339780 missense probably benign 0.41
R8915:Zfp944 UTSW 17 22339526 missense probably benign 0.05
R9130:Zfp944 UTSW 17 22341050 missense probably damaging 1.00
R9248:Zfp944 UTSW 17 22343638 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACATTTGTAAGGTTTCTCTCCTG -3'
(R):5'- GGGATACACATGTTAAGTCATCAGATG -3'

Sequencing Primer
(F):5'- AAGGTTTCTCTCCTGTATGAATTTTC -3'
(R):5'- TCAGATGTAAACAGACATGAAACTG -3'
Posted On 2020-09-02