Incidental Mutation 'R8328:Kremen2'
ID644222
Institutional Source Beutler Lab
Gene Symbol Kremen2
Ensembl Gene ENSMUSG00000040680
Gene Namekringle containing transmembrane protein 2
Synonyms2900054E04Rik, Krm2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23741197-23745833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23742771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 254 (V254A)
Ref Sequence ENSEMBL: ENSMUSP00000046369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024702] [ENSMUST00000046525]
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046525
AA Change: V254A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046369
Gene: ENSMUSG00000040680
AA Change: V254A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
KR 33 120 2.44e-18 SMART
Pfam:WSC 123 204 1.3e-20 PFAM
CUB 218 325 8.04e-15 SMART
Blast:CUB 351 422 8e-6 BLAST
low complexity region 446 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Kremen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02327:Kremen2 APN 17 23743569 missense probably benign 0.11
R0057:Kremen2 UTSW 17 23743228 missense possibly damaging 0.94
R0369:Kremen2 UTSW 17 23742810 missense probably benign 0.02
R0835:Kremen2 UTSW 17 23742837 missense probably damaging 0.99
R0847:Kremen2 UTSW 17 23744660 missense probably damaging 1.00
R1733:Kremen2 UTSW 17 23743399 splice site probably null
R2056:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2057:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2058:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2173:Kremen2 UTSW 17 23742796 missense probably damaging 0.98
R5553:Kremen2 UTSW 17 23741802 unclassified probably benign
R5583:Kremen2 UTSW 17 23742255 missense probably benign 0.00
R6057:Kremen2 UTSW 17 23742705 missense probably benign 0.00
R6510:Kremen2 UTSW 17 23743655 missense possibly damaging 0.91
R7068:Kremen2 UTSW 17 23741885 missense possibly damaging 0.87
R7227:Kremen2 UTSW 17 23744599 nonsense probably null
R7382:Kremen2 UTSW 17 23743552 splice site probably null
R8113:Kremen2 UTSW 17 23743802 missense probably damaging 1.00
R8167:Kremen2 UTSW 17 23743340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCTCTGGAGATGCTCTGC -3'
(R):5'- ACCTGCGCTGGAAAGAAAGC -3'

Sequencing Primer
(F):5'- TGAGCATGGCCTCTTGC -3'
(R):5'- CGCTGGAAAGAAAGCCAAGCTG -3'
Posted On2020-09-02