Incidental Mutation 'R8328:Dsg1b'
ID644225
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20376950 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 6 (F6I)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably benign
Transcript: ENSMUST00000076737
AA Change: F6I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: F6I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Stn1 C A 19: 47,517,059 R152L probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R8209:Dsg1b UTSW 18 20408890 missense probably benign 0.36
R8283:Dsg1b UTSW 18 20391906 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGAAGGCAGAAACACCTC -3'
(R):5'- ACATGGTTTGGTGAGTGGACAC -3'

Sequencing Primer
(F):5'- ACCTCAAAGCCTGCATGTAAG -3'
(R):5'- TGGTGAGTGGACACTGGCAC -3'
Posted On2020-09-02