Incidental Mutation 'R8328:Stn1'
ID644227
Institutional Source Beutler Lab
Gene Symbol Stn1
Ensembl Gene ENSMUSG00000042694
Gene NameSTN1, CST complex subunit
Synonyms0610009H20Rik, 2310057J23Rik, Obfc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R8328 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47501033-47537507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47517059 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 152 (R152L)
Ref Sequence ENSEMBL: ENSMUSP00000040944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049369] [ENSMUST00000182808]
PDB Structure
Solution structure of the hypothetical domain of RIKEN cDNA 0610009H20 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000049369
AA Change: R152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040944
Gene: ENSMUSG00000042694
AA Change: R152L

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.4e-8 PFAM
Pfam:tRNA_anti-codon 64 165 3e-8 PFAM
Pfam:STN1_2 167 344 7.9e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182808
AA Change: R152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138727
Gene: ENSMUSG00000042694
AA Change: R152L

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.8e-5 PFAM
Pfam:tRNA_anti-codon 64 165 4.1e-7 PFAM
Pfam:STN1_2 167 330 2.7e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] OBFC1 and C17ORF68 (MIM 613129) are subunits of an alpha accessory factor (AAF) that stimulates the activity of DNA polymerase-alpha-primase (see MIM 176636), the enzyme that initiates DNA replication (Casteel et al., 2009 [PubMed 19119139]). OBFC1 also appears to function in a telomere-associated complex with C17ORF68 and TEN1 (C17ORF106; MIM 613130) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,890,012 M682K probably benign Het
Ankdd1b T A 13: 96,454,866 I42F possibly damaging Het
Ankrd6 C T 4: 32,810,215 E489K probably benign Het
Arhgef28 A T 13: 98,051,009 H259Q possibly damaging Het
C3 T C 17: 57,220,973 S749G probably benign Het
Celsr1 A G 15: 85,922,244 S2338P probably benign Het
Ces2a A T 8: 104,737,366 N210I probably damaging Het
Cuzd1 A T 7: 131,311,616 V424D probably damaging Het
Cyp2j11 T A 4: 96,348,368 H67L probably benign Het
Dennd5b A G 6: 149,020,617 S800P probably damaging Het
Dmrta2 G T 4: 109,980,009 L49F unknown Het
Dpy19l1 T A 9: 24,475,390 K9* probably null Het
Dsc2 T C 18: 20,032,519 H843R possibly damaging Het
Dsg1b T A 18: 20,376,950 F6I probably benign Het
Fam214b T C 4: 43,034,751 T323A probably benign Het
Gm13084 A G 4: 143,810,810 L317P probably damaging Het
Hck C T 2: 153,129,067 A83V probably damaging Het
Hdc T C 2: 126,601,883 E292G probably damaging Het
Ighv1-23 A G 12: 114,764,496 L102P probably damaging Het
Kdm3b G A 18: 34,793,070 V88M probably damaging Het
Kremen2 A G 17: 23,742,771 V254A probably benign Het
Lrrc8e T A 8: 4,235,641 I622N probably damaging Het
Megf8 A G 7: 25,347,492 N1600S probably benign Het
Mical3 A G 6: 120,935,177 I1907T probably damaging Het
Nr4a3 T A 4: 48,051,323 Y26N probably damaging Het
Nrl T C 14: 55,520,706 E188G probably damaging Het
Olfr311 T A 11: 58,841,634 D173E probably benign Het
Olfr464 A G 11: 87,914,159 M249T possibly damaging Het
Polr1a G A 6: 71,920,734 E238K probably benign Het
Prr5 G C 15: 84,703,186 *388S probably null Het
Rptor A G 11: 119,892,647 T1156A probably benign Het
Slc9c1 T A 16: 45,577,864 I664K probably damaging Het
Syde2 T C 3: 146,015,741 V1121A probably benign Het
Vmn1r158 T C 7: 22,790,062 T241A probably damaging Het
Vmn1r209 C A 13: 22,806,473 V16L probably benign Het
Wdr19 A G 5: 65,225,295 E454G probably damaging Het
Zan C T 5: 137,394,464 E4590K unknown Het
Zfp579 T G 7: 4,994,867 H15P unknown Het
Zfp628 A G 7: 4,919,814 N345S probably benign Het
Zfp944 T A 17: 22,339,724 K181* probably null Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Stn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Stn1 APN 19 47516173 missense possibly damaging 0.71
IGL02338:Stn1 APN 19 47513890 missense probably damaging 1.00
R0309:Stn1 UTSW 19 47501673 missense probably benign 0.01
R1552:Stn1 UTSW 19 47536373 critical splice acceptor site probably null
R3907:Stn1 UTSW 19 47507823 missense probably damaging 1.00
R5866:Stn1 UTSW 19 47517129 missense probably benign 0.12
R6652:Stn1 UTSW 19 47507578 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGAAATTATCCAAACTTCCC -3'
(R):5'- AAGGACCCTCGCTTATACCTC -3'

Sequencing Primer
(F):5'- AGCTCTTTTCCTAAAAACGGC -3'
(R):5'- AGGACCCTCGCTTATACCTCTTCTC -3'
Posted On2020-09-02