Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Spag16'

644230

Institutional Source

Beutler Lab

Gene Symbol

Spag16

Ensembl Gene

ENSMUSG00000053153

Gene Name

sperm associated antigen 16

Synonyms

4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69826970-70725132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69895248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 278 (I278T)

Ref Sequence

ENSEMBL: ENSMUSP00000069821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]

AlphaFold

Q8K450

Predicted Effect

probably benign
Transcript: ENSMUST00000065425
AA Change: I278T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: I278T

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
WD40	349	388	7.8e-2	SMART
WD40	391	430	6.23e-10	SMART
WD40	433	472	1.34e-9	SMART
WD40	475	514	1.92e-10	SMART
WD40	517	556	2.38e-6	SMART
WD40	559	598	1.42e2	SMART
WD40	600	639	4.83e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000113940
AA Change: I278T

SMART Domains

Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: I278T

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
low complexity region	342	347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Spag16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Spag16	APN	1	70299650	missense	probably damaging	1.00
IGL01129:Spag16	APN	1	69896522	missense	probably benign	0.01
IGL02117:Spag16	APN	1	69870320	missense	probably damaging	1.00
IGL02245:Spag16	APN	1	69858502	missense	probably benign
IGL02492:Spag16	APN	1	69887529	missense	probably benign
IGL02851:Spag16	APN	1	70264908	missense	possibly damaging	0.76
IGL03271:Spag16	APN	1	69853352	missense	probably benign	0.00
IGL03274:Spag16	APN	1	69844381	splice site	probably benign
PIT4243001:Spag16	UTSW	1	69853381	missense	probably damaging	1.00
R0084:Spag16	UTSW	1	69996839	missense	probably benign	0.02
R0513:Spag16	UTSW	1	70493768	splice site	probably benign
R0653:Spag16	UTSW	1	69870345	missense	probably damaging	1.00
R1165:Spag16	UTSW	1	69996877	missense	probably benign	0.04
R1178:Spag16	UTSW	1	69923658	splice site	probably benign
R1180:Spag16	UTSW	1	69923658	splice site	probably benign
R1404:Spag16	UTSW	1	69895280	splice site	probably benign
R1547:Spag16	UTSW	1	69873243	missense	possibly damaging	0.51
R1689:Spag16	UTSW	1	70461118	missense	probably benign	0.01
R1699:Spag16	UTSW	1	69996856	missense	probably benign	0.05
R1714:Spag16	UTSW	1	69843005	missense	probably damaging	0.97
R1724:Spag16	UTSW	1	70493782	missense	probably damaging	1.00
R1873:Spag16	UTSW	1	69896585	splice site	probably benign
R2196:Spag16	UTSW	1	69858522	missense	possibly damaging	0.92
R2207:Spag16	UTSW	1	70724884	missense	probably benign	0.00
R4058:Spag16	UTSW	1	69853328	missense	probably damaging	0.96
R4276:Spag16	UTSW	1	69873481	intron	probably benign
R4497:Spag16	UTSW	1	70493830	missense	probably damaging	1.00
R4560:Spag16	UTSW	1	69844296	missense	probably benign	0.05
R4648:Spag16	UTSW	1	69827035	missense	probably null	0.99
R4972:Spag16	UTSW	1	70724928	missense	probably damaging	1.00
R5027:Spag16	UTSW	1	69923804	intron	probably benign
R5032:Spag16	UTSW	1	69853352	missense	probably benign	0.00
R5174:Spag16	UTSW	1	70493796	missense	probably damaging	1.00
R5276:Spag16	UTSW	1	69896583	critical splice donor site	probably null
R5537:Spag16	UTSW	1	69827016	missense	probably benign
R5706:Spag16	UTSW	1	69870289	missense	probably benign	0.01
R5834:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R6131:Spag16	UTSW	1	70725083	splice site	probably null
R6246:Spag16	UTSW	1	69923821	missense	probably benign	0.45
R7164:Spag16	UTSW	1	70724866	missense	possibly damaging	0.88
R7261:Spag16	UTSW	1	70299621	missense	possibly damaging	0.56
R7298:Spag16	UTSW	1	69919426	splice site	probably null
R7358:Spag16	UTSW	1	69844367	missense	probably benign	0.00
R7431:Spag16	UTSW	1	69923872	missense	unknown
R7508:Spag16	UTSW	1	69887520	missense	possibly damaging	0.93
R7566:Spag16	UTSW	1	69870328	missense	probably damaging	1.00
R7570:Spag16	UTSW	1	69996841	missense	probably benign	0.00
R7598:Spag16	UTSW	1	69870308	missense	probably damaging	1.00
R7942:Spag16	UTSW	1	69827088	missense	probably benign	0.11
R8047:Spag16	UTSW	1	69842996	missense	probably damaging	1.00
R8132:Spag16	UTSW	1	70381302	missense	probably damaging	1.00
R8870:Spag16	UTSW	1	69996858	missense	probably benign	0.05
R8930:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8932:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8954:Spag16	UTSW	1	69996845	missense
R8998:Spag16	UTSW	1	69896547	missense	probably benign	0.00
R9077:Spag16	UTSW	1	70493771	splice site	probably benign
R9144:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9145:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9148:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9160:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R9192:Spag16	UTSW	1	69923848	missense	unknown
R9436:Spag16	UTSW	1	69853380	missense	probably damaging	0.96
R9582:Spag16	UTSW	1	69858558	missense	probably benign	0.00
R9660:Spag16	UTSW	1	69923683	missense	probably benign	0.03
R9666:Spag16	UTSW	1	70724913	missense	probably damaging	1.00
R9671:Spag16	UTSW	1	69844336	missense	probably benign	0.29
R9728:Spag16	UTSW	1	69923683	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACCCTGAACTGATTTCACTACAG -3'
(R):5'- TGCTGAATTGGGGTGAGAATACTC -3'

Sequencing Primer
(F):5'- TGAACTGATTTCACTACAGAGAAAAG -3'
(R):5'- CTCTTGATGTTAAGAACAGGTAG -3'

Posted On

2020-09-02