Incidental Mutation 'R8329:Spag16'
ID644230
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R8329 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69895248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 278 (I278T)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably benign
Transcript: ENSMUST00000065425
AA Change: I278T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: I278T

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113940
AA Change: I278T
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: I278T

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 splice site probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 splice site probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
R7942:Spag16 UTSW 1 69827088 missense probably benign 0.11
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8132:Spag16 UTSW 1 70381302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGAACTGATTTCACTACAG -3'
(R):5'- TGCTGAATTGGGGTGAGAATACTC -3'

Sequencing Primer
(F):5'- TGAACTGATTTCACTACAGAGAAAAG -3'
(R):5'- CTCTTGATGTTAAGAACAGGTAG -3'
Posted On2020-09-02