Incidental Mutation 'R8329:Ripor3'
ID 644240
Institutional Source Beutler Lab
Gene Symbol Ripor3
Ensembl Gene ENSMUSG00000074577
Gene Name RIPOR family member 3
Synonyms Fam65c, 2310033K02Rik
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8329 (G1)
Quality Score 210.009
Status Validated
Chromosome 2
Chromosomal Location 167822084-167852538 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167825119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 797 (R797G)
Ref Sequence ENSEMBL: ENSMUSP00000096672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053] [ENSMUST00000099073]
AlphaFold A1L3T7
Predicted Effect probably benign
Transcript: ENSMUST00000029053
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099073
AA Change: R797G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577
AA Change: R797G

DomainStartEndE-ValueType
Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Ripor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Ripor3 APN 2 167,835,495 (GRCm39) missense probably benign 0.05
IGL01621:Ripor3 APN 2 167,839,172 (GRCm39) missense probably damaging 0.97
IGL01819:Ripor3 APN 2 167,822,763 (GRCm39) missense probably damaging 0.99
IGL01891:Ripor3 APN 2 167,825,071 (GRCm39) missense possibly damaging 0.95
IGL02110:Ripor3 APN 2 167,836,626 (GRCm39) missense possibly damaging 0.95
IGL02270:Ripor3 APN 2 167,835,416 (GRCm39) missense probably damaging 0.97
IGL02403:Ripor3 APN 2 167,831,250 (GRCm39) missense probably damaging 1.00
IGL02445:Ripor3 APN 2 167,834,682 (GRCm39) splice site probably benign
IGL02447:Ripor3 APN 2 167,834,750 (GRCm39) missense probably damaging 0.99
IGL02711:Ripor3 APN 2 167,848,200 (GRCm39) utr 5 prime probably benign
IGL03187:Ripor3 APN 2 167,827,588 (GRCm39) missense possibly damaging 0.64
IGL03304:Ripor3 APN 2 167,822,848 (GRCm39) splice site probably benign
R0062:Ripor3 UTSW 2 167,826,358 (GRCm39) splice site probably benign
R0062:Ripor3 UTSW 2 167,826,358 (GRCm39) splice site probably benign
R0233:Ripor3 UTSW 2 167,834,518 (GRCm39) missense probably damaging 1.00
R0233:Ripor3 UTSW 2 167,834,518 (GRCm39) missense probably damaging 1.00
R0387:Ripor3 UTSW 2 167,825,692 (GRCm39) nonsense probably null
R1457:Ripor3 UTSW 2 167,834,573 (GRCm39) missense probably damaging 1.00
R1481:Ripor3 UTSW 2 167,842,297 (GRCm39) missense possibly damaging 0.95
R1619:Ripor3 UTSW 2 167,822,765 (GRCm39) missense probably damaging 0.96
R2358:Ripor3 UTSW 2 167,825,785 (GRCm39) splice site probably benign
R2431:Ripor3 UTSW 2 167,831,715 (GRCm39) missense probably benign 0.06
R2943:Ripor3 UTSW 2 167,825,681 (GRCm39) missense possibly damaging 0.46
R3000:Ripor3 UTSW 2 167,833,100 (GRCm39) missense probably damaging 1.00
R3730:Ripor3 UTSW 2 167,834,739 (GRCm39) missense probably damaging 1.00
R3731:Ripor3 UTSW 2 167,834,739 (GRCm39) missense probably damaging 1.00
R4084:Ripor3 UTSW 2 167,826,386 (GRCm39) missense possibly damaging 0.55
R4796:Ripor3 UTSW 2 167,823,260 (GRCm39) missense probably damaging 0.97
R4854:Ripor3 UTSW 2 167,834,733 (GRCm39) missense probably benign 0.05
R4934:Ripor3 UTSW 2 167,824,736 (GRCm39) missense probably benign
R4968:Ripor3 UTSW 2 167,827,037 (GRCm39) missense probably benign 0.41
R5662:Ripor3 UTSW 2 167,835,476 (GRCm39) missense probably benign 0.01
R5739:Ripor3 UTSW 2 167,823,203 (GRCm39) missense probably damaging 1.00
R5888:Ripor3 UTSW 2 167,839,207 (GRCm39) missense probably damaging 1.00
R6844:Ripor3 UTSW 2 167,835,253 (GRCm39) splice site probably null
R6969:Ripor3 UTSW 2 167,827,657 (GRCm39) missense probably benign 0.01
R6994:Ripor3 UTSW 2 167,839,186 (GRCm39) missense probably damaging 0.99
R7609:Ripor3 UTSW 2 167,826,490 (GRCm39) missense possibly damaging 0.86
R7818:Ripor3 UTSW 2 167,831,346 (GRCm39) missense probably benign 0.09
R8175:Ripor3 UTSW 2 167,825,679 (GRCm39) missense probably benign 0.00
R9120:Ripor3 UTSW 2 167,822,835 (GRCm39) missense possibly damaging 0.79
R9130:Ripor3 UTSW 2 167,823,267 (GRCm39) nonsense probably null
R9408:Ripor3 UTSW 2 167,831,238 (GRCm39) missense probably benign 0.09
R9550:Ripor3 UTSW 2 167,822,807 (GRCm39) missense probably benign 0.23
R9660:Ripor3 UTSW 2 167,831,646 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATGACCCCAAAATTGATCAC -3'
(R):5'- GGAGGCATCCTGGAAATTTAGGC -3'

Sequencing Primer
(F):5'- AAATTGATCACCTTTTCCCGGAAGC -3'
(R):5'- CTCATGGTGTAGCCTAGACTGAC -3'
Posted On 2020-09-02