Incidental Mutation 'R8329:Gcn1'
ID 644248
Institutional Source Beutler Lab
Gene Symbol Gcn1
Ensembl Gene ENSMUSG00000041638
Gene Name GCN1 activator of EIF2AK4
Synonyms Gcn1l1, G431004K08Rik, GCN1L
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115703313-115760713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 115747921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1776 (G1776E)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
AlphaFold E9PVA8
Predicted Effect probably damaging
Transcript: ENSMUST00000064454
AA Change: G1776E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: G1776E

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Gcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1 APN 5 115,726,202 (GRCm39) splice site probably benign
IGL00974:Gcn1 APN 5 115,751,852 (GRCm39) missense possibly damaging 0.88
IGL01566:Gcn1 APN 5 115,749,117 (GRCm39) missense probably damaging 1.00
IGL01843:Gcn1 APN 5 115,757,759 (GRCm39) missense probably damaging 1.00
IGL01885:Gcn1 APN 5 115,714,174 (GRCm39) splice site probably null
IGL02081:Gcn1 APN 5 115,723,930 (GRCm39) missense probably damaging 1.00
IGL02118:Gcn1 APN 5 115,748,938 (GRCm39) missense probably damaging 1.00
IGL02150:Gcn1 APN 5 115,747,927 (GRCm39) missense probably damaging 1.00
IGL02190:Gcn1 APN 5 115,752,183 (GRCm39) missense probably damaging 1.00
IGL02219:Gcn1 APN 5 115,751,826 (GRCm39) missense possibly damaging 0.68
IGL02507:Gcn1 APN 5 115,723,940 (GRCm39) missense probably benign 0.11
IGL02644:Gcn1 APN 5 115,713,250 (GRCm39) missense probably benign
IGL02678:Gcn1 APN 5 115,751,814 (GRCm39) missense probably damaging 0.99
IGL02748:Gcn1 APN 5 115,748,859 (GRCm39) splice site probably null
IGL02755:Gcn1 APN 5 115,742,065 (GRCm39) splice site probably null
IGL02896:Gcn1 APN 5 115,757,707 (GRCm39) splice site probably benign
cusp UTSW 5 115,749,119 (GRCm39) missense probably damaging 1.00
farthing UTSW 5 115,714,167 (GRCm39) splice site probably benign
IGL03147:Gcn1 UTSW 5 115,748,917 (GRCm39) missense possibly damaging 0.78
R0362:Gcn1 UTSW 5 115,714,167 (GRCm39) splice site probably benign
R0540:Gcn1 UTSW 5 115,727,015 (GRCm39) missense probably benign 0.00
R0569:Gcn1 UTSW 5 115,733,118 (GRCm39) missense probably benign 0.00
R0570:Gcn1 UTSW 5 115,730,480 (GRCm39) missense probably damaging 1.00
R0584:Gcn1 UTSW 5 115,733,074 (GRCm39) missense probably damaging 1.00
R0630:Gcn1 UTSW 5 115,719,148 (GRCm39) missense probably benign 0.06
R0656:Gcn1 UTSW 5 115,727,362 (GRCm39) missense probably benign 0.27
R0801:Gcn1 UTSW 5 115,729,065 (GRCm39) missense probably benign 0.12
R0890:Gcn1 UTSW 5 115,717,852 (GRCm39) missense possibly damaging 0.77
R1400:Gcn1 UTSW 5 115,752,220 (GRCm39) missense probably damaging 1.00
R1485:Gcn1 UTSW 5 115,712,676 (GRCm39) missense probably benign
R1574:Gcn1 UTSW 5 115,753,611 (GRCm39) missense probably benign
R1574:Gcn1 UTSW 5 115,753,611 (GRCm39) missense probably benign
R1673:Gcn1 UTSW 5 115,720,356 (GRCm39) missense probably benign
R1894:Gcn1 UTSW 5 115,727,174 (GRCm39) missense probably damaging 1.00
R2114:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2116:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2117:Gcn1 UTSW 5 115,736,884 (GRCm39) missense probably benign 0.35
R2152:Gcn1 UTSW 5 115,747,888 (GRCm39) missense probably benign 0.07
R2162:Gcn1 UTSW 5 115,730,191 (GRCm39) missense probably benign 0.18
R2216:Gcn1 UTSW 5 115,731,720 (GRCm39) missense probably benign
R2218:Gcn1 UTSW 5 115,757,720 (GRCm39) missense probably benign 0.04
R2278:Gcn1 UTSW 5 115,749,234 (GRCm39) missense probably damaging 1.00
R2280:Gcn1 UTSW 5 115,750,789 (GRCm39) missense probably damaging 1.00
R3719:Gcn1 UTSW 5 115,717,876 (GRCm39) missense probably benign 0.03
R3729:Gcn1 UTSW 5 115,721,453 (GRCm39) splice site probably benign
R3833:Gcn1 UTSW 5 115,730,191 (GRCm39) missense probably benign 0.18
R3932:Gcn1 UTSW 5 115,725,893 (GRCm39) missense probably benign 0.11
R4067:Gcn1 UTSW 5 115,737,147 (GRCm39) missense probably damaging 1.00
R4152:Gcn1 UTSW 5 115,751,413 (GRCm39) critical splice acceptor site probably null
R4179:Gcn1 UTSW 5 115,726,109 (GRCm39) missense probably benign 0.00
R4292:Gcn1 UTSW 5 115,714,207 (GRCm39) missense possibly damaging 0.49
R4350:Gcn1 UTSW 5 115,741,389 (GRCm39) missense probably damaging 1.00
R4493:Gcn1 UTSW 5 115,732,203 (GRCm39) missense probably benign
R4672:Gcn1 UTSW 5 115,744,579 (GRCm39) missense probably damaging 1.00
R4749:Gcn1 UTSW 5 115,752,461 (GRCm39) missense probably benign
R4753:Gcn1 UTSW 5 115,754,537 (GRCm39) missense probably benign
R4826:Gcn1 UTSW 5 115,731,752 (GRCm39) missense probably benign
R4873:Gcn1 UTSW 5 115,714,229 (GRCm39) missense possibly damaging 0.92
R4875:Gcn1 UTSW 5 115,714,229 (GRCm39) missense possibly damaging 0.92
R4932:Gcn1 UTSW 5 115,730,203 (GRCm39) missense probably benign 0.00
R4992:Gcn1 UTSW 5 115,737,225 (GRCm39) missense probably benign 0.29
R5049:Gcn1 UTSW 5 115,744,730 (GRCm39) missense probably damaging 1.00
R5211:Gcn1 UTSW 5 115,757,371 (GRCm39) missense probably benign 0.04
R5226:Gcn1 UTSW 5 115,726,126 (GRCm39) missense probably benign 0.01
R5338:Gcn1 UTSW 5 115,721,462 (GRCm39) missense probably benign 0.00
R5914:Gcn1 UTSW 5 115,748,194 (GRCm39) synonymous silent
R5932:Gcn1 UTSW 5 115,730,435 (GRCm39) missense possibly damaging 0.77
R6422:Gcn1 UTSW 5 115,747,603 (GRCm39) missense probably damaging 1.00
R6435:Gcn1 UTSW 5 115,749,081 (GRCm39) critical splice acceptor site probably null
R6607:Gcn1 UTSW 5 115,747,537 (GRCm39) missense probably damaging 0.98
R6724:Gcn1 UTSW 5 115,747,217 (GRCm39) splice site probably null
R6861:Gcn1 UTSW 5 115,749,108 (GRCm39) missense probably benign
R6875:Gcn1 UTSW 5 115,726,169 (GRCm39) missense probably damaging 1.00
R6910:Gcn1 UTSW 5 115,744,597 (GRCm39) missense probably benign 0.42
R6975:Gcn1 UTSW 5 115,751,518 (GRCm39) missense probably damaging 1.00
R7027:Gcn1 UTSW 5 115,754,605 (GRCm39) critical splice donor site probably null
R7038:Gcn1 UTSW 5 115,749,203 (GRCm39) missense probably damaging 1.00
R7171:Gcn1 UTSW 5 115,728,352 (GRCm39) missense probably benign 0.02
R7276:Gcn1 UTSW 5 115,749,119 (GRCm39) missense probably damaging 1.00
R7456:Gcn1 UTSW 5 115,743,005 (GRCm39) nonsense probably null
R7473:Gcn1 UTSW 5 115,719,863 (GRCm39) missense probably benign 0.09
R7517:Gcn1 UTSW 5 115,757,755 (GRCm39) missense probably benign 0.01
R7714:Gcn1 UTSW 5 115,733,359 (GRCm39) missense probably damaging 0.97
R7752:Gcn1 UTSW 5 115,753,627 (GRCm39) missense probably damaging 1.00
R7812:Gcn1 UTSW 5 115,731,751 (GRCm39) missense possibly damaging 0.91
R7922:Gcn1 UTSW 5 115,752,527 (GRCm39) missense probably benign
R8070:Gcn1 UTSW 5 115,727,057 (GRCm39) missense probably benign 0.09
R8218:Gcn1 UTSW 5 115,719,588 (GRCm39) missense probably benign 0.00
R8413:Gcn1 UTSW 5 115,717,698 (GRCm39) missense probably benign 0.00
R8795:Gcn1 UTSW 5 115,752,454 (GRCm39) missense probably benign 0.02
R8802:Gcn1 UTSW 5 115,747,942 (GRCm39) missense probably damaging 1.00
R8899:Gcn1 UTSW 5 115,717,220 (GRCm39) missense probably benign 0.04
R8946:Gcn1 UTSW 5 115,733,404 (GRCm39) missense probably benign 0.02
R8963:Gcn1 UTSW 5 115,727,153 (GRCm39) missense probably benign 0.25
R9006:Gcn1 UTSW 5 115,719,566 (GRCm39) missense probably benign 0.22
R9163:Gcn1 UTSW 5 115,742,944 (GRCm39) missense probably benign
R9177:Gcn1 UTSW 5 115,719,867 (GRCm39) missense probably benign 0.35
R9187:Gcn1 UTSW 5 115,752,177 (GRCm39) missense probably damaging 1.00
R9411:Gcn1 UTSW 5 115,733,098 (GRCm39) missense possibly damaging 0.87
R9541:Gcn1 UTSW 5 115,754,416 (GRCm39) missense probably benign 0.00
R9574:Gcn1 UTSW 5 115,713,341 (GRCm39) missense possibly damaging 0.89
R9630:Gcn1 UTSW 5 115,741,349 (GRCm39) missense probably damaging 0.99
R9651:Gcn1 UTSW 5 115,747,665 (GRCm39) critical splice donor site probably null
R9761:Gcn1 UTSW 5 115,729,064 (GRCm39) missense probably benign 0.05
R9765:Gcn1 UTSW 5 115,735,131 (GRCm39) nonsense probably null
Z1177:Gcn1 UTSW 5 115,752,208 (GRCm39) missense probably damaging 0.99
Z1191:Gcn1 UTSW 5 115,713,352 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATGGCTGATTCCATCCTTGC -3'
(R):5'- AGCGTACATCGAGATGACCC -3'

Sequencing Primer
(F):5'- GATTCCATCCTTGCCCTTCAGG -3'
(R):5'- GAACTCGTTCTCATCAGCCAGAG -3'
Posted On 2020-09-02