Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Gcn1l1'

644248

Institutional Source

Beutler Lab

Gene Symbol

Gcn1l1

Ensembl Gene

ENSMUSG00000041638

Gene Name

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

Synonyms

GCN1L, G431004K08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115565254-115622654 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 115609862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 1776 (G1776E)

Ref Sequence

ENSEMBL: ENSMUSP00000069432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454]

AlphaFold

E9PVA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000064454
AA Change: G1776E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: G1776E

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Gcn1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00869:Gcn1l1	APN	5	115588143	splice site	probably benign
IGL00974:Gcn1l1	APN	5	115613793	missense	possibly damaging	0.88
IGL01566:Gcn1l1	APN	5	115611058	missense	probably damaging	1.00
IGL01843:Gcn1l1	APN	5	115619700	missense	probably damaging	1.00
IGL01885:Gcn1l1	APN	5	115576115	splice site	probably null
IGL02081:Gcn1l1	APN	5	115585871	missense	probably damaging	1.00
IGL02118:Gcn1l1	APN	5	115610879	missense	probably damaging	1.00
IGL02150:Gcn1l1	APN	5	115609868	missense	probably damaging	1.00
IGL02190:Gcn1l1	APN	5	115614124	missense	probably damaging	1.00
IGL02219:Gcn1l1	APN	5	115613767	missense	possibly damaging	0.68
IGL02507:Gcn1l1	APN	5	115585881	missense	probably benign	0.11
IGL02644:Gcn1l1	APN	5	115575191	missense	probably benign
IGL02678:Gcn1l1	APN	5	115613755	missense	probably damaging	0.99
IGL02748:Gcn1l1	APN	5	115610800	splice site	probably null
IGL02755:Gcn1l1	APN	5	115604006	splice site	probably null
IGL02896:Gcn1l1	APN	5	115619648	splice site	probably benign
cusp	UTSW	5	115611060	missense	probably damaging	1.00
farthing	UTSW	5	115576108	splice site	probably benign
IGL03147:Gcn1l1	UTSW	5	115610858	missense	possibly damaging	0.78
R0362:Gcn1l1	UTSW	5	115576108	splice site	probably benign
R0540:Gcn1l1	UTSW	5	115588956	missense	probably benign	0.00
R0569:Gcn1l1	UTSW	5	115595059	missense	probably benign	0.00
R0570:Gcn1l1	UTSW	5	115592421	missense	probably damaging	1.00
R0584:Gcn1l1	UTSW	5	115595015	missense	probably damaging	1.00
R0630:Gcn1l1	UTSW	5	115581089	missense	probably benign	0.06
R0656:Gcn1l1	UTSW	5	115589303	missense	probably benign	0.27
R0801:Gcn1l1	UTSW	5	115591006	missense	probably benign	0.12
R0890:Gcn1l1	UTSW	5	115579793	missense	possibly damaging	0.77
R1400:Gcn1l1	UTSW	5	115614161	missense	probably damaging	1.00
R1485:Gcn1l1	UTSW	5	115574617	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1673:Gcn1l1	UTSW	5	115582297	missense	probably benign
R1894:Gcn1l1	UTSW	5	115589115	missense	probably damaging	1.00
R2114:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2116:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2117:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2152:Gcn1l1	UTSW	5	115609829	missense	probably benign	0.07
R2162:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R2216:Gcn1l1	UTSW	5	115593661	missense	probably benign
R2218:Gcn1l1	UTSW	5	115619661	missense	probably benign	0.04
R2278:Gcn1l1	UTSW	5	115611175	missense	probably damaging	1.00
R2280:Gcn1l1	UTSW	5	115612730	missense	probably damaging	1.00
R3719:Gcn1l1	UTSW	5	115579817	missense	probably benign	0.03
R3729:Gcn1l1	UTSW	5	115583394	splice site	probably benign
R3833:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R3932:Gcn1l1	UTSW	5	115587834	missense	probably benign	0.11
R4067:Gcn1l1	UTSW	5	115599088	missense	probably damaging	1.00
R4152:Gcn1l1	UTSW	5	115613354	critical splice acceptor site	probably null
R4179:Gcn1l1	UTSW	5	115588050	missense	probably benign	0.00
R4292:Gcn1l1	UTSW	5	115576148	missense	possibly damaging	0.49
R4350:Gcn1l1	UTSW	5	115603330	missense	probably damaging	1.00
R4493:Gcn1l1	UTSW	5	115594144	missense	probably benign
R4672:Gcn1l1	UTSW	5	115606520	missense	probably damaging	1.00
R4749:Gcn1l1	UTSW	5	115614402	missense	probably benign
R4753:Gcn1l1	UTSW	5	115616478	missense	probably benign
R4826:Gcn1l1	UTSW	5	115593693	missense	probably benign
R4873:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4875:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4932:Gcn1l1	UTSW	5	115592144	missense	probably benign	0.00
R4992:Gcn1l1	UTSW	5	115599166	missense	probably benign	0.29
R5049:Gcn1l1	UTSW	5	115606671	missense	probably damaging	1.00
R5211:Gcn1l1	UTSW	5	115619312	missense	probably benign	0.04
R5226:Gcn1l1	UTSW	5	115588067	missense	probably benign	0.01
R5338:Gcn1l1	UTSW	5	115583403	missense	probably benign	0.00
R5914:Gcn1l1	UTSW	5	115610135	synonymous	silent
R5932:Gcn1l1	UTSW	5	115592376	missense	possibly damaging	0.77
R6422:Gcn1l1	UTSW	5	115609544	missense	probably damaging	1.00
R6435:Gcn1l1	UTSW	5	115611022	critical splice acceptor site	probably null
R6607:Gcn1l1	UTSW	5	115609478	missense	probably damaging	0.98
R6724:Gcn1l1	UTSW	5	115609158	splice site	probably null
R6861:Gcn1l1	UTSW	5	115611049	missense	probably benign
R6875:Gcn1l1	UTSW	5	115588110	missense	probably damaging	1.00
R6910:Gcn1l1	UTSW	5	115606538	missense	probably benign	0.42
R6975:Gcn1l1	UTSW	5	115613459	missense	probably damaging	1.00
R7027:Gcn1l1	UTSW	5	115616546	critical splice donor site	probably null
R7038:Gcn1l1	UTSW	5	115611144	missense	probably damaging	1.00
R7171:Gcn1l1	UTSW	5	115590293	missense	probably benign	0.02
R7276:Gcn1l1	UTSW	5	115611060	missense	probably damaging	1.00
R7456:Gcn1l1	UTSW	5	115604946	nonsense	probably null
R7473:Gcn1l1	UTSW	5	115581804	missense	probably benign	0.09
R7517:Gcn1l1	UTSW	5	115619696	missense	probably benign	0.01
R7714:Gcn1l1	UTSW	5	115595300	missense	probably damaging	0.97
R7752:Gcn1l1	UTSW	5	115615568	missense	probably damaging	1.00
R7812:Gcn1l1	UTSW	5	115593692	missense	possibly damaging	0.91
R7922:Gcn1l1	UTSW	5	115614468	missense	probably benign
R8070:Gcn1l1	UTSW	5	115588998	missense	probably benign	0.09
R8218:Gcn1l1	UTSW	5	115581529	missense	probably benign	0.00
R8413:Gcn1l1	UTSW	5	115579639	missense	probably benign	0.00
R8795:Gcn1l1	UTSW	5	115614395	missense	probably benign	0.02
R8802:Gcn1l1	UTSW	5	115609883	missense	probably damaging	1.00
R8899:Gcn1l1	UTSW	5	115579161	missense	probably benign	0.04
R8946:Gcn1l1	UTSW	5	115595345	missense	probably benign	0.02
R8963:Gcn1l1	UTSW	5	115589094	missense	probably benign	0.25
R9006:Gcn1l1	UTSW	5	115581507	missense	probably benign	0.22
R9163:Gcn1l1	UTSW	5	115604885	missense	probably benign
R9177:Gcn1l1	UTSW	5	115581808	missense	probably benign	0.35
R9187:Gcn1l1	UTSW	5	115614118	missense	probably damaging	1.00
R9411:Gcn1l1	UTSW	5	115595039	missense	possibly damaging	0.87
R9541:Gcn1l1	UTSW	5	115616357	missense	probably benign	0.00
R9574:Gcn1l1	UTSW	5	115575282	missense	possibly damaging	0.89
R9630:Gcn1l1	UTSW	5	115603290	missense	probably damaging	0.99
R9651:Gcn1l1	UTSW	5	115609606	critical splice donor site	probably null
R9761:Gcn1l1	UTSW	5	115591005	missense	probably benign	0.05
R9765:Gcn1l1	UTSW	5	115597072	nonsense	probably null
Z1177:Gcn1l1	UTSW	5	115614149	missense	probably damaging	0.99
Z1191:Gcn1l1	UTSW	5	115575293	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- ATGGCTGATTCCATCCTTGC -3'
(R):5'- AGCGTACATCGAGATGACCC -3'

Sequencing Primer
(F):5'- GATTCCATCCTTGCCCTTCAGG -3'
(R):5'- GAACTCGTTCTCATCAGCCAGAG -3'

Posted On

2020-09-02