Incidental Mutation 'R8329:Atg7'
ID 644250
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Name autophagy related 7
Synonyms 1810013K23Rik, Apg7l
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 114620075-114837565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114663057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 224 (D224E)
Ref Sequence ENSEMBL: ENSMUSP00000133215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
AlphaFold Q9D906
Predicted Effect possibly damaging
Transcript: ENSMUST00000032457
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314
AA Change: D181E

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169310
AA Change: D224E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: D224E

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182034
AA Change: D197E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314
AA Change: D197E

DomainStartEndE-ValueType
PDB:3VX8|A 25 231 1e-39 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000182035
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314
AA Change: D181E

DomainStartEndE-ValueType
PDB:3VX8|A 9 222 9e-40 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000182428
AA Change: D181E

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314
AA Change: D181E

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182510
SMART Domains Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 159 8e-37 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000182793
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314
AA Change: D181E

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182902
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314
AA Change: D181E

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183165
AA Change: D142E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314
AA Change: D142E

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114,701,884 (GRCm39) missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114,680,325 (GRCm39) missense probably damaging 0.99
R1467:Atg7 UTSW 6 114,835,943 (GRCm39) splice site probably benign
R1561:Atg7 UTSW 6 114,678,133 (GRCm39) missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114,650,638 (GRCm39) missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114,678,196 (GRCm39) missense probably damaging 0.98
R1962:Atg7 UTSW 6 114,683,191 (GRCm39) missense probably damaging 1.00
R1964:Atg7 UTSW 6 114,683,191 (GRCm39) missense probably damaging 1.00
R2064:Atg7 UTSW 6 114,680,324 (GRCm39) missense probably damaging 1.00
R3722:Atg7 UTSW 6 114,672,624 (GRCm39) missense probably damaging 0.99
R3870:Atg7 UTSW 6 114,674,008 (GRCm39) missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114,650,639 (GRCm39) missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114,678,939 (GRCm39) missense probably benign 0.00
R4111:Atg7 UTSW 6 114,690,255 (GRCm39) missense probably damaging 0.98
R4212:Atg7 UTSW 6 114,680,386 (GRCm39) missense probably benign 0.02
R4943:Atg7 UTSW 6 114,674,045 (GRCm39) missense probably benign 0.25
R5216:Atg7 UTSW 6 114,701,910 (GRCm39) missense probably damaging 0.96
R5465:Atg7 UTSW 6 114,629,493 (GRCm39) missense probably benign
R5555:Atg7 UTSW 6 114,679,014 (GRCm39) missense probably damaging 1.00
R5618:Atg7 UTSW 6 114,650,660 (GRCm39) missense probably damaging 0.99
R5902:Atg7 UTSW 6 114,650,639 (GRCm39) missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114,683,254 (GRCm39) nonsense probably null
R5980:Atg7 UTSW 6 114,657,197 (GRCm39) missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114,648,194 (GRCm39) missense probably benign 0.01
R6031:Atg7 UTSW 6 114,648,194 (GRCm39) missense probably benign 0.01
R6178:Atg7 UTSW 6 114,701,856 (GRCm39) missense probably damaging 1.00
R6702:Atg7 UTSW 6 114,648,058 (GRCm39) splice site probably null
R6924:Atg7 UTSW 6 114,686,172 (GRCm39) critical splice donor site probably null
R6941:Atg7 UTSW 6 114,650,639 (GRCm39) missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114,754,018 (GRCm39) missense probably damaging 1.00
R7561:Atg7 UTSW 6 114,650,002 (GRCm39) missense possibly damaging 0.80
R8070:Atg7 UTSW 6 114,674,041 (GRCm39) missense probably benign 0.03
R8170:Atg7 UTSW 6 114,678,151 (GRCm39) missense probably benign 0.11
R8367:Atg7 UTSW 6 114,663,060 (GRCm39) missense probably benign
R9084:Atg7 UTSW 6 114,678,896 (GRCm39) missense probably damaging 1.00
R9221:Atg7 UTSW 6 114,672,588 (GRCm39) missense possibly damaging 0.94
R9411:Atg7 UTSW 6 114,690,289 (GRCm39) missense probably benign 0.41
R9622:Atg7 UTSW 6 114,654,993 (GRCm39) missense probably benign 0.00
Z1088:Atg7 UTSW 6 114,672,647 (GRCm39) missense probably benign 0.15
Z1176:Atg7 UTSW 6 114,650,011 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTGTGTGAAGGCATAGCACAG -3'
(R):5'- ACATACCGTGGAGGGCTAAG -3'

Sequencing Primer
(F):5'- GCATAGCACAGGGAAAATGTTATAG -3'
(R):5'- GACTAAGCTTCAAATCGATAGTGGTC -3'
Posted On 2020-09-02