Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Atg7'

644250

Institutional Source

Beutler Lab

Gene Symbol

Atg7

Ensembl Gene

ENSMUSG00000030314

Gene Name

autophagy related 7

Synonyms

1810013K23Rik, Apg7l

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114643097-114860614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114686096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 224 (D224E)

Ref Sequence

ENSEMBL: ENSMUSP00000133215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]

AlphaFold

Q9D906

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032457
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314
AA Change: D181E

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169310
AA Change: D224E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: D224E

Domain	Start	End	E-Value	Type
Pfam:ATG7_N	9	319	1.5e-106	PFAM
Pfam:ThiF	329	643	7.9e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182034
AA Change: D197E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314
AA Change: D197E

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	25	231	1e-39	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182035
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314
AA Change: D181E

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	9	222	9e-40	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182428
AA Change: D181E

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314
AA Change: D181E

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.1e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182510

SMART Domains

Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	9	159	8e-37	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182793
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314
AA Change: D181E

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182902
AA Change: D181E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314
AA Change: D181E

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183165
AA Change: D142E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314
AA Change: D142E

Domain	Start	End	E-Value	Type
Pfam:ThiF	311	467	9.7e-38	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Atg7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02969:Atg7	APN	6	114724923	missense	possibly damaging	0.71
R1460:Atg7	UTSW	6	114703364	missense	probably damaging	0.99
R1467:Atg7	UTSW	6	114858982	splice site	probably benign
R1561:Atg7	UTSW	6	114701172	missense	possibly damaging	0.52
R1755:Atg7	UTSW	6	114673677	missense	possibly damaging	0.64
R1934:Atg7	UTSW	6	114701235	missense	probably damaging	0.98
R1962:Atg7	UTSW	6	114706230	missense	probably damaging	1.00
R1964:Atg7	UTSW	6	114706230	missense	probably damaging	1.00
R2064:Atg7	UTSW	6	114703363	missense	probably damaging	1.00
R3722:Atg7	UTSW	6	114695663	missense	probably damaging	0.99
R3870:Atg7	UTSW	6	114697047	missense	possibly damaging	0.71
R3926:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R4044:Atg7	UTSW	6	114701978	missense	probably benign	0.00
R4111:Atg7	UTSW	6	114713294	missense	probably damaging	0.98
R4212:Atg7	UTSW	6	114703425	missense	probably benign	0.02
R4943:Atg7	UTSW	6	114697084	missense	probably benign	0.25
R5216:Atg7	UTSW	6	114724949	missense	probably damaging	0.96
R5465:Atg7	UTSW	6	114652532	missense	probably benign
R5555:Atg7	UTSW	6	114702053	missense	probably damaging	1.00
R5618:Atg7	UTSW	6	114673699	missense	probably damaging	0.99
R5902:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R5903:Atg7	UTSW	6	114706293	nonsense	probably null
R5980:Atg7	UTSW	6	114680236	missense	possibly damaging	0.80
R6031:Atg7	UTSW	6	114671233	missense	probably benign	0.01
R6031:Atg7	UTSW	6	114671233	missense	probably benign	0.01
R6178:Atg7	UTSW	6	114724895	missense	probably damaging	1.00
R6702:Atg7	UTSW	6	114671097	splice site	probably null
R6924:Atg7	UTSW	6	114709211	critical splice donor site	probably null
R6941:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R7201:Atg7	UTSW	6	114777057	missense	probably damaging	1.00
R7561:Atg7	UTSW	6	114673041	missense	possibly damaging	0.80
R8070:Atg7	UTSW	6	114697080	missense	probably benign	0.03
R8170:Atg7	UTSW	6	114701190	missense	probably benign	0.11
R8367:Atg7	UTSW	6	114686099	missense	probably benign
R9084:Atg7	UTSW	6	114701935	missense	probably damaging	1.00
R9221:Atg7	UTSW	6	114695627	missense	possibly damaging	0.94
R9411:Atg7	UTSW	6	114713328	missense	probably benign	0.41
R9622:Atg7	UTSW	6	114678032	missense	probably benign	0.00
Z1088:Atg7	UTSW	6	114695686	missense	probably benign	0.15
Z1176:Atg7	UTSW	6	114673050	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTTGTGTGAAGGCATAGCACAG -3'
(R):5'- ACATACCGTGGAGGGCTAAG -3'

Sequencing Primer
(F):5'- GCATAGCACAGGGAAAATGTTATAG -3'
(R):5'- GACTAAGCTTCAAATCGATAGTGGTC -3'

Posted On

2020-09-02