Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Muc6'

644257

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141633456-141655319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141640258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1501 (P1501S)

Ref Sequence

ENSEMBL: ENSMUSP00000140483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000062451
AA Change: P1501S

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: P1501S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000190907
AA Change: P1501S

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: P1501S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141645902	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141638890	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141648066	nonsense	probably null
IGL01021:Muc6	APN	7	141637162	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141648454	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141646659	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141638614	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141651307	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141650041	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141649804	nonsense	probably null
IGL01810:Muc6	APN	7	141651062	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141639850	intron	probably benign
IGL02192:Muc6	APN	7	141637804	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141649624	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141640575	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141641496	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141640459	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141636940	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141649578	splice site	probably benign
IGL02851:Muc6	APN	7	141648361	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141640147	intron	probably benign
IGL03070:Muc6	APN	7	141644567	splice site	probably benign
IGL03108:Muc6	APN	7	141637489	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141652059	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141648082	missense	probably damaging	1.00
anticipation	UTSW	7	141634450	frame shift	probably null
F5770:Muc6	UTSW	7	141647613	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141634116	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141639559	intron	probably benign
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141636955	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141652283	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141640468	missense	probably benign
R0503:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141638584	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141639559	intron	probably benign
R0880:Muc6	UTSW	7	141637357	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141644233	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141645855	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141640197	intron	probably benign
R1293:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141647909	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141652103	splice site	probably benign
R1548:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1576:Muc6	UTSW	7	141634524	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141647998	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141650487	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141634458	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141637098	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141640062	nonsense	probably null
R1964:Muc6	UTSW	7	141640063	intron	probably benign
R1975:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141634078	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141649810	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141646960	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141637924	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141637531	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141640384	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141637038	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141648681	splice site	probably benign
R3872:Muc6	UTSW	7	141640600	missense	probably benign
R4029:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141648655	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141637663	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141640089	intron	probably benign
R4509:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141644222	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141639790	intron	probably benign
R4678:Muc6	UTSW	7	141644287	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141640159	intron	probably benign
R4737:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4981:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141639559	intron	probably benign
R5012:Muc6	UTSW	7	141636657	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141640528	missense	probably benign
R5027:Muc6	UTSW	7	141636436	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141644224	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141639559	intron	probably benign
R5179:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141651110	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141637923	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141648813	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141636535	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141649585	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141640423	splice site	probably benign
R5808:Muc6	UTSW	7	141640093	intron	probably benign
R5865:Muc6	UTSW	7	141650504	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141641570	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141648374	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141640525	missense	probably benign
R6236:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141648821	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141651115	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141639610	intron	probably benign
R6609:Muc6	UTSW	7	141640433	splice site	probably benign
R6610:Muc6	UTSW	7	141640433	splice site	probably benign
R6611:Muc6	UTSW	7	141640433	splice site	probably benign
R6623:Muc6	UTSW	7	141639559	intron	probably benign
R6626:Muc6	UTSW	7	141639559	intron	probably benign
R6817:Muc6	UTSW	7	141651061	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141637540	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141639979	intron	probably benign
R7001:Muc6	UTSW	7	141637407	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141640189	intron	probably benign
R7097:Muc6	UTSW	7	141634450	frame shift	probably null
R7099:Muc6	UTSW	7	141634450	frame shift	probably null
R7101:Muc6	UTSW	7	141634450	frame shift	probably null
R7107:Muc6	UTSW	7	141634450	frame shift	probably null
R7108:Muc6	UTSW	7	141634450	frame shift	probably null
R7112:Muc6	UTSW	7	141649277	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141634450	frame shift	probably null
R7204:Muc6	UTSW	7	141634450	frame shift	probably null
R7205:Muc6	UTSW	7	141634450	frame shift	probably null
R7222:Muc6	UTSW	7	141634515	missense	unknown
R7230:Muc6	UTSW	7	141649214	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141640575	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141639823	missense	unknown
R7501:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141636541	missense	unknown
R7641:Muc6	UTSW	7	141639825	missense	unknown
R7644:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141648658	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141637060	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141639825	missense	unknown
R7679:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141651057	splice site	probably null
R7806:Muc6	UTSW	7	141637474	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141640371	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141645921	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141645420	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141645481	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141640462	missense	unknown
R8130:Muc6	UTSW	7	141647087	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141649408	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141640528	missense	unknown
R8294:Muc6	UTSW	7	141637350	missense	possibly damaging	0.96
R8379:Muc6	UTSW	7	141644312	nonsense	probably null
R8537:Muc6	UTSW	7	141647917	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141642172	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141643282	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141647524	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141637105	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141640084	missense	unknown
R9023:Muc6	UTSW	7	141651167	nonsense	probably null
R9058:Muc6	UTSW	7	141638241	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141640471	missense	unknown
R9495:Muc6	UTSW	7	141651133	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141636397	missense	unknown
R9787:Muc6	UTSW	7	141641481	nonsense	probably null
R9788:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141647613	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141647613	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141651699	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141637914	missense	possibly damaging	0.72
Z1177:Muc6	UTSW	7	141650436	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141651391	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- GCTGATGAGACCATTTGTGAGC -3'
(R):5'- TAGCGCCGAGTACTTATACAACC -3'

Sequencing Primer
(F):5'- AGACCATTTGTGAGCTTGTTGGC -3'
(R):5'- CCAAAACTTGTTCTCCACAGG -3'

Posted On

2020-09-02