Incidental Mutation 'R0068:Ppp1r9b'
ID64426
Institutional Source Beutler Lab
Gene Symbol Ppp1r9b
Ensembl Gene ENSMUSG00000038976
Gene Nameprotein phosphatase 1, regulatory subunit 9B
SynonymsSPL, Spn, spinophilin, neurabin II
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0068 (G1)
Quality Score157
Status Validated
Chromosome11
Chromosomal Location94991035-95006899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95001220 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 154 (F154V)
Ref Sequence ENSEMBL: ENSMUSP00000103377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]
Predicted Effect probably damaging
Transcript: ENSMUST00000038696
AA Change: F578V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: F578V

DomainStartEndE-ValueType
low complexity region 64 83 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 253 260 N/A INTRINSIC
low complexity region 281 317 N/A INTRINSIC
low complexity region 332 361 N/A INTRINSIC
low complexity region 399 430 N/A INTRINSIC
Blast:PDZ 431 458 4e-10 BLAST
PDZ 504 584 7.03e-19 SMART
low complexity region 600 612 N/A INTRINSIC
Blast:PDZ 731 768 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107748
AA Change: F154V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976
AA Change: F154V

DomainStartEndE-ValueType
PDZ 80 160 7.03e-19 SMART
low complexity region 176 188 N/A INTRINSIC
Blast:PDZ 307 344 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151771
Meta Mutation Damage Score 0.2211 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Ppp1r9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Ppp1r9b APN 11 95005354 missense probably damaging 0.96
IGL02261:Ppp1r9b APN 11 95002110 missense probably damaging 1.00
R0719:Ppp1r9b UTSW 11 95001835 splice site probably null
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1385:Ppp1r9b UTSW 11 94992211 missense probably benign 0.06
R1639:Ppp1r9b UTSW 11 94996610 missense probably damaging 1.00
R1642:Ppp1r9b UTSW 11 95001324 synonymous silent
R2000:Ppp1r9b UTSW 11 94996620 missense probably damaging 1.00
R2162:Ppp1r9b UTSW 11 94998051 missense probably damaging 1.00
R2332:Ppp1r9b UTSW 11 94996609 missense probably damaging 0.96
R3815:Ppp1r9b UTSW 11 94992533 missense probably damaging 1.00
R4426:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R4427:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R5121:Ppp1r9b UTSW 11 94996653 missense probably damaging 0.99
R5205:Ppp1r9b UTSW 11 95001298 missense probably benign 0.11
R5348:Ppp1r9b UTSW 11 94996612 nonsense probably null
R5397:Ppp1r9b UTSW 11 95002110 missense probably damaging 1.00
R5399:Ppp1r9b UTSW 11 94992148 missense probably benign
R6188:Ppp1r9b UTSW 11 94991836 missense probably damaging 0.99
R6860:Ppp1r9b UTSW 11 94992148 missense probably benign
R7308:Ppp1r9b UTSW 11 95004571 missense possibly damaging 0.86
R7357:Ppp1r9b UTSW 11 95004598 missense probably benign 0.00
R7479:Ppp1r9b UTSW 11 94992032 missense possibly damaging 0.85
R7587:Ppp1r9b UTSW 11 95001940 missense possibly damaging 0.65
R7651:Ppp1r9b UTSW 11 95001942 missense probably benign 0.03
R7871:Ppp1r9b UTSW 11 95001909 missense probably damaging 1.00
R7954:Ppp1r9b UTSW 11 95001909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGGCTATTCCCCATTCCCGAG -3'
(R):5'- CGCTGCTTCATCTAACCACCAGAG -3'

Sequencing Primer
(F):5'- AAGCATGGTTGACAGCCC -3'
(R):5'- TCTAACCACCAGAGGGCAG -3'
Posted On2013-08-06