Incidental Mutation 'R8329:Terb1'
ID644260
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Nametelomere repeat binding bouquet formation protein 1
SynonymsCcdc79, 4930532D21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8329 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104446719-104509910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104484371 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 341 (N341K)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
PDB Structure
Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000064576
AA Change: N341K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: N341K

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159713
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161520
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 104451807 missense probably benign 0.09
IGL01468:Terb1 APN 8 104482167 intron probably benign
IGL01619:Terb1 APN 8 104473014 missense probably benign 0.00
IGL01631:Terb1 APN 8 104472864 missense probably damaging 0.99
IGL02041:Terb1 APN 8 104495114 missense probably damaging 1.00
IGL02413:Terb1 APN 8 104494868 critical splice donor site probably null
IGL02974:Terb1 APN 8 104494968 nonsense probably null
IGL03091:Terb1 APN 8 104469154 missense probably benign 0.03
IGL03410:Terb1 APN 8 104473042 splice site probably benign
R0825:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R0906:Terb1 UTSW 8 104452636 missense probably damaging 1.00
R1175:Terb1 UTSW 8 104484306 missense probably benign 0.07
R1494:Terb1 UTSW 8 104498490 splice site probably benign
R1657:Terb1 UTSW 8 104488491 missense possibly damaging 0.77
R2018:Terb1 UTSW 8 104452699 missense probably benign 0.00
R2029:Terb1 UTSW 8 104498100 splice site probably benign
R2047:Terb1 UTSW 8 104485462 missense probably damaging 1.00
R2062:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R2179:Terb1 UTSW 8 104452715 missense probably damaging 0.99
R2179:Terb1 UTSW 8 104472737 missense probably benign 0.08
R2187:Terb1 UTSW 8 104472884 missense probably benign
R2420:Terb1 UTSW 8 104498595 missense probably damaging 1.00
R2867:Terb1 UTSW 8 104447853 unclassified probably benign
R3749:Terb1 UTSW 8 104496834 missense probably damaging 1.00
R4850:Terb1 UTSW 8 104485425 missense probably benign 0.02
R4930:Terb1 UTSW 8 104447948 missense probably benign 0.00
R4963:Terb1 UTSW 8 104482318 missense probably damaging 1.00
R4969:Terb1 UTSW 8 104495163 missense probably benign 0.00
R5100:Terb1 UTSW 8 104495173 nonsense probably null
R5440:Terb1 UTSW 8 104488499 missense probably damaging 1.00
R5824:Terb1 UTSW 8 104485447 missense probably benign 0.08
R5950:Terb1 UTSW 8 104488485 critical splice donor site probably null
R5985:Terb1 UTSW 8 104451807 missense probably benign 0.09
R5985:Terb1 UTSW 8 104482316 missense probably damaging 1.00
R6320:Terb1 UTSW 8 104447199 missense probably damaging 1.00
R6432:Terb1 UTSW 8 104485446 missense possibly damaging 0.65
R6473:Terb1 UTSW 8 104473037 missense probably damaging 1.00
R6701:Terb1 UTSW 8 104472756 missense possibly damaging 0.69
R7013:Terb1 UTSW 8 104488590 nonsense probably null
R7064:Terb1 UTSW 8 104488554 missense probably benign 0.00
R7237:Terb1 UTSW 8 104495327 missense possibly damaging 0.85
R7361:Terb1 UTSW 8 104468799 missense probably damaging 1.00
R7549:Terb1 UTSW 8 104498084 missense possibly damaging 0.85
R7915:Terb1 UTSW 8 104447216 missense possibly damaging 0.59
R8112:Terb1 UTSW 8 104468767 missense probably benign 0.32
R8256:Terb1 UTSW 8 104472947 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTCACTATGTCTGACAGC -3'
(R):5'- AGAATGTGGCTACATGTTAGAAATC -3'

Sequencing Primer
(F):5'- TGTAGATGTCACTGGCCTAAACC -3'
(R):5'- GCGATGAATCATGATCTCA -3'
Posted On2020-09-02