Incidental Mutation 'R8329:Gprc6a'
ID 644269
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 51503355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 169 (Y169*)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably null
Transcript: ENSMUST00000020062
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: Y169*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
AA Change: Y169*
Predicted Effect probably null
Transcript: ENSMUST00000219286
AA Change: Y169*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACACATTGTTTTCAGCAGCC -3'
(R):5'- TCCATAATGACATCAACCAGGTTC -3'

Sequencing Primer
(F):5'- CAGCAGCCTGTATTGCAAATGTG -3'
(R):5'- ATCCCTGGGTGCTAAGAT -3'
Posted On 2020-09-02