Incidental Mutation 'R8329:Gls2'
ID 644272
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Name glutaminase 2 (liver, mitochondrial)
Synonyms Lga, A330074B06Rik
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 128030504-128045873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128037154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 232 (T232A)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000123291] [ENSMUST00000143827] [ENSMUST00000159440]
AlphaFold Q571F8
Predicted Effect probably benign
Transcript: ENSMUST00000044776
AA Change: T232A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: T232A

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123291
Predicted Effect
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005
AA Change: H197R

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Slc36a3 A G 11: 55,039,409 (GRCm39) L73P probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128,036,840 (GRCm39) splice site probably null
IGL00583:Gls2 APN 10 128,040,751 (GRCm39) missense probably benign 0.11
IGL01444:Gls2 APN 10 128,037,216 (GRCm39) missense probably damaging 1.00
IGL02746:Gls2 APN 10 128,036,825 (GRCm39) missense probably damaging 1.00
R0015:Gls2 UTSW 10 128,045,219 (GRCm39) missense probably damaging 1.00
R0024:Gls2 UTSW 10 128,035,125 (GRCm39) missense probably damaging 1.00
R0378:Gls2 UTSW 10 128,043,180 (GRCm39) missense probably benign
R1179:Gls2 UTSW 10 128,035,103 (GRCm39) missense probably damaging 1.00
R1227:Gls2 UTSW 10 128,035,533 (GRCm39) missense probably damaging 1.00
R1421:Gls2 UTSW 10 128,037,217 (GRCm39) nonsense probably null
R1750:Gls2 UTSW 10 128,037,194 (GRCm39) missense probably damaging 1.00
R1952:Gls2 UTSW 10 128,045,231 (GRCm39) missense probably benign
R2218:Gls2 UTSW 10 128,040,583 (GRCm39) missense probably damaging 1.00
R2291:Gls2 UTSW 10 128,043,479 (GRCm39) nonsense probably null
R2382:Gls2 UTSW 10 128,039,711 (GRCm39) missense probably damaging 1.00
R4536:Gls2 UTSW 10 128,036,806 (GRCm39) missense probably benign 0.00
R5305:Gls2 UTSW 10 128,040,578 (GRCm39) nonsense probably null
R5435:Gls2 UTSW 10 128,030,995 (GRCm39) intron probably benign
R5767:Gls2 UTSW 10 128,041,090 (GRCm39) missense probably damaging 1.00
R7223:Gls2 UTSW 10 128,035,063 (GRCm39) missense probably benign
R7767:Gls2 UTSW 10 128,030,998 (GRCm39) missense unknown
R8068:Gls2 UTSW 10 128,030,983 (GRCm39) missense unknown
R8084:Gls2 UTSW 10 128,035,125 (GRCm39) missense probably damaging 1.00
R8872:Gls2 UTSW 10 128,040,535 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCATTTATGCCCAGGTGG -3'
(R):5'- CCTACCTGGATGAGAGCAAAG -3'

Sequencing Primer
(F):5'- CCTTTAATCTCAGGACTCAGGAGG -3'
(R):5'- GCAAAGGCTAAGACACAGAGG -3'
Posted On 2020-09-02