Incidental Mutation 'R8329:Slc36a3'
ID 644273
Institutional Source Beutler Lab
Gene Symbol Slc36a3
Ensembl Gene ENSMUSG00000049491
Gene Name solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms TRAMD2, PAT3, tramdorin2
MMRRC Submission 067859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 55015641-55042534 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55039409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 73 (L73P)
Ref Sequence ENSEMBL: ENSMUSP00000020502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020502] [ENSMUST00000069816] [ENSMUST00000128244]
AlphaFold Q811P0
Predicted Effect probably damaging
Transcript: ENSMUST00000020502
AA Change: L73P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020502
Gene: ENSMUSG00000049491
AA Change: L73P

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 459 7.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069816
SMART Domains Protein: ENSMUSP00000064960
Gene: ENSMUSG00000049491

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128244
AA Change: L73P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116073
Gene: ENSMUSG00000049491
AA Change: L73P

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 87 2.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,461,978 (GRCm39) probably null Het
Ackr4 A G 9: 103,976,660 (GRCm39) F96L possibly damaging Het
Aco1 T C 4: 40,186,376 (GRCm39) I596T possibly damaging Het
Aff3 G A 1: 38,244,135 (GRCm39) R879W probably benign Het
Apob A G 12: 8,061,135 (GRCm39) R3206G probably damaging Het
Atg7 T A 6: 114,663,057 (GRCm39) D224E possibly damaging Het
Capn12 T C 7: 28,582,626 (GRCm39) F167S probably damaging Het
Ccdc3 T G 2: 5,233,848 (GRCm39) V224G probably damaging Het
Ces4a G A 8: 105,874,714 (GRCm39) V452I probably damaging Het
Cherp G A 8: 73,215,852 (GRCm39) R834C Het
Clptm1l T A 13: 73,760,547 (GRCm39) I310N probably damaging Het
Cog3 A T 14: 75,978,003 (GRCm39) D230E probably damaging Het
Crb1 T A 1: 139,165,005 (GRCm39) I1101F probably damaging Het
Cts6 A T 13: 61,343,282 (GRCm39) M313K probably damaging Het
Cyp2c66 T A 19: 39,174,906 (GRCm39) C435* probably null Het
Defb13 A G 8: 22,438,562 (GRCm39) E40G probably benign Het
Dis3l T C 9: 64,219,112 (GRCm39) D606G possibly damaging Het
Dop1b T C 16: 93,568,675 (GRCm39) L1579P probably damaging Het
Foxa3 A G 7: 18,748,109 (GRCm39) V339A probably benign Het
Gcn1 G A 5: 115,747,921 (GRCm39) G1776E probably damaging Het
Gls2 A G 10: 128,037,154 (GRCm39) T232A probably benign Het
Gprc6a A T 10: 51,503,355 (GRCm39) Y169* probably null Het
Guca2b T C 4: 119,516,001 (GRCm39) S18G unknown Het
Hars2 A G 18: 36,922,288 (GRCm39) D301G possibly damaging Het
Haus5 T A 7: 30,358,984 (GRCm39) Q226L possibly damaging Het
Hc G A 2: 34,902,910 (GRCm39) probably null Het
Hivep2 T C 10: 14,004,011 (GRCm39) V203A probably damaging Het
Hoxc8 A G 15: 102,899,543 (GRCm39) Y111C probably damaging Het
Hoxd13 G T 2: 74,498,661 (GRCm39) R3L probably benign Het
Hspa8 T G 9: 40,713,897 (GRCm39) I130S probably damaging Het
Ier5l C A 2: 30,362,861 (GRCm39) C388F possibly damaging Het
Ldc1 C T 4: 130,109,156 (GRCm39) V295M possibly damaging Het
Lmx1a A G 1: 167,517,372 (GRCm39) N10S probably benign Het
Map2 T C 1: 66,454,272 (GRCm39) I1054T probably benign Het
Me1 C T 9: 86,501,790 (GRCm39) D268N probably damaging Het
Muc6 G A 7: 141,226,525 (GRCm39) P1501S unknown Het
Myo1d T C 11: 80,528,900 (GRCm39) M641V probably benign Het
Nuggc G A 14: 65,878,731 (GRCm39) R667K probably benign Het
Oprl1 T A 2: 181,360,717 (GRCm39) C231S probably damaging Het
Or11g26 T C 14: 50,753,015 (GRCm39) F118S probably damaging Het
Or13p10 A C 4: 118,523,604 (GRCm39) N297H probably damaging Het
Pard3b C A 1: 62,676,957 (GRCm39) Q1163K probably benign Het
Pik3c2a T C 7: 116,017,283 (GRCm39) Y158C probably damaging Het
Prune2 T G 19: 17,098,629 (GRCm39) S1378A probably benign Het
Ralgps2 G T 1: 156,712,110 (GRCm39) T158K probably damaging Het
Rbm42 T A 7: 30,344,582 (GRCm39) E227V unknown Het
Ripor3 T C 2: 167,825,119 (GRCm39) R797G possibly damaging Het
Ryr3 T A 2: 112,492,855 (GRCm39) H3764L possibly damaging Het
Sbno2 T C 10: 79,900,221 (GRCm39) Y541C probably damaging Het
Scn5a A G 9: 119,365,030 (GRCm39) V396A probably damaging Het
Spag16 T C 1: 69,934,407 (GRCm39) I278T probably benign Het
Stx18 T A 5: 38,285,450 (GRCm39) L274* probably null Het
Terb1 A T 8: 105,211,003 (GRCm39) N341K probably damaging Het
Timm29 A G 9: 21,505,001 (GRCm39) Y223C probably damaging Het
Tmprss2 T A 16: 97,369,665 (GRCm39) M370L probably benign Het
Tmtc3 T A 10: 100,283,296 (GRCm39) N753I probably damaging Het
Tnpo3 A T 6: 29,558,832 (GRCm39) C699* probably null Het
Trav5d-4 G A 14: 53,239,208 (GRCm39) W13* probably null Het
Trdn A G 10: 33,320,074 (GRCm39) probably null Het
Tsg101 A T 7: 46,558,808 (GRCm39) Y68N probably damaging Het
Ttn A G 2: 76,664,062 (GRCm39) V11649A unknown Het
Wnk2 A T 13: 49,248,914 (GRCm39) V379D probably damaging Het
Xpnpep1 A G 19: 52,990,903 (GRCm39) probably null Het
Yme1l1 C T 2: 23,054,597 (GRCm39) Q139* probably null Het
Other mutations in Slc36a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03104:Slc36a3 APN 11 55,015,946 (GRCm39) missense probably damaging 1.00
IGL03241:Slc36a3 APN 11 55,015,934 (GRCm39) missense possibly damaging 0.95
R0632:Slc36a3 UTSW 11 55,015,906 (GRCm39) missense probably damaging 1.00
R1117:Slc36a3 UTSW 11 55,037,006 (GRCm39) missense possibly damaging 0.78
R1549:Slc36a3 UTSW 11 55,033,596 (GRCm39) missense probably damaging 1.00
R3423:Slc36a3 UTSW 11 55,033,607 (GRCm39) missense probably benign 0.00
R3425:Slc36a3 UTSW 11 55,033,607 (GRCm39) missense probably benign 0.00
R3791:Slc36a3 UTSW 11 55,015,982 (GRCm39) missense possibly damaging 0.95
R3980:Slc36a3 UTSW 11 55,026,209 (GRCm39) missense probably benign
R4970:Slc36a3 UTSW 11 55,039,399 (GRCm39) missense probably damaging 1.00
R4973:Slc36a3 UTSW 11 55,037,630 (GRCm39) splice site probably benign
R4986:Slc36a3 UTSW 11 55,037,592 (GRCm39) makesense probably null
R5112:Slc36a3 UTSW 11 55,039,399 (GRCm39) missense probably damaging 1.00
R5399:Slc36a3 UTSW 11 55,037,006 (GRCm39) missense possibly damaging 0.78
R5534:Slc36a3 UTSW 11 55,033,595 (GRCm39) missense possibly damaging 0.83
R5580:Slc36a3 UTSW 11 55,026,279 (GRCm39) missense probably benign 0.14
R5682:Slc36a3 UTSW 11 55,016,489 (GRCm39) missense probably benign 0.00
R5779:Slc36a3 UTSW 11 55,026,094 (GRCm39) nonsense probably null
R5841:Slc36a3 UTSW 11 55,016,547 (GRCm39) nonsense probably null
R6228:Slc36a3 UTSW 11 55,015,777 (GRCm39) missense probably benign 0.01
R6483:Slc36a3 UTSW 11 55,026,089 (GRCm39) missense probably benign 0.01
R6908:Slc36a3 UTSW 11 55,040,712 (GRCm39) intron probably benign
R6927:Slc36a3 UTSW 11 55,020,519 (GRCm39) missense probably damaging 0.98
R7828:Slc36a3 UTSW 11 55,042,024 (GRCm39) missense probably benign 0.00
R7995:Slc36a3 UTSW 11 55,020,495 (GRCm39) missense probably benign 0.04
R8212:Slc36a3 UTSW 11 55,015,907 (GRCm39) missense probably damaging 1.00
R8238:Slc36a3 UTSW 11 55,022,433 (GRCm39) missense probably benign 0.05
R8239:Slc36a3 UTSW 11 55,022,433 (GRCm39) missense probably benign 0.05
R8929:Slc36a3 UTSW 11 55,028,137 (GRCm39) missense probably damaging 1.00
R9034:Slc36a3 UTSW 11 55,016,515 (GRCm39) missense probably damaging 0.99
R9489:Slc36a3 UTSW 11 55,040,726 (GRCm39) missense unknown
R9506:Slc36a3 UTSW 11 55,039,457 (GRCm39) missense probably benign 0.14
R9661:Slc36a3 UTSW 11 55,015,984 (GRCm39) missense probably benign 0.00
R9696:Slc36a3 UTSW 11 55,026,161 (GRCm39) missense possibly damaging 0.52
R9735:Slc36a3 UTSW 11 55,026,104 (GRCm39) missense probably damaging 1.00
Z1177:Slc36a3 UTSW 11 55,026,278 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTGCTCAGTATGCTTCCTGG -3'
(R):5'- AGTCACAGAGCTGGTTCTCTC -3'

Sequencing Primer
(F):5'- CTTCCTGGTTGGTTCTAAGAAAC -3'
(R):5'- TTCCCAACAAGTGTACTCGC -3'
Posted On 2020-09-02