Incidental Mutation 'R8329:Myo1d'
ID644274
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8329 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80638074 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 641 (M641V)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably benign
Transcript: ENSMUST00000041065
AA Change: M641V

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: M641V

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070997
AA Change: M641V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: M641V

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGGCACGAAGTTCTTCC -3'
(R):5'- GAGTCCTTTATTCATGAGCATTGTC -3'

Sequencing Primer
(F):5'- CACGAAGTTCTTCCAGGGTGAAC -3'
(R):5'- CTCTAAAGAGAGTGCTTCCTAGGTC -3'
Posted On2020-09-02