Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Myo1d'

644274

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

067859-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80638074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 641 (M641V)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

probably benign
Transcript: ENSMUST00000041065
AA Change: M641V

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: M641V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000070997
AA Change: M641V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: M641V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Clptm1l	T	A	13: 73,612,428	I310N	probably damaging	Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTGGGCACGAAGTTCTTCC -3'
(R):5'- GAGTCCTTTATTCATGAGCATTGTC -3'

Sequencing Primer
(F):5'- CACGAAGTTCTTCCAGGGTGAAC -3'
(R):5'- CTCTAAAGAGAGTGCTTCCTAGGTC -3'

Posted On

2020-09-02