Mutagenetix > Incidental Mutation

Incidental Mutation 'R8329:Clptm1l'

644278

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

067859-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73612428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 310 (I310N)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably damaging
Transcript: ENSMUST00000022102
AA Change: I310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: I310N

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,543,741		probably null	Het
Ackr4	A	G	9: 104,099,461	F96L	possibly damaging	Het
Aco1	T	C	4: 40,186,376	I596T	possibly damaging	Het
Aff3	G	A	1: 38,205,054	R879W	probably benign	Het
Apob	A	G	12: 8,011,135	R3206G	probably damaging	Het
Atg7	T	A	6: 114,686,096	D224E	possibly damaging	Het
Capn12	T	C	7: 28,883,201	F167S	probably damaging	Het
Ccdc3	T	G	2: 5,229,037	V224G	probably damaging	Het
Ces4a	G	A	8: 105,148,082	V452I	probably damaging	Het
Cherp	G	A	8: 72,462,008	R834C		Het
Cog3	A	T	14: 75,740,563	D230E	probably damaging	Het
Crb1	T	A	1: 139,237,267	I1101F	probably damaging	Het
Cts6	A	T	13: 61,195,468	M313K	probably damaging	Het
Cyp2c66	T	A	19: 39,186,462	C435*	probably null	Het
Defb13	A	G	8: 21,948,546	E40G	probably benign	Het
Dis3l	T	C	9: 64,311,830	D606G	possibly damaging	Het
Dopey2	T	C	16: 93,771,787	L1579P	probably damaging	Het
Foxa3	A	G	7: 19,014,184	V339A	probably benign	Het
Gcn1l1	G	A	5: 115,609,862	G1776E	probably damaging	Het
Gls2	A	G	10: 128,201,285	T232A	probably benign	Het
Gm853	C	T	4: 130,215,363	V295M	possibly damaging	Het
Gprc6a	A	T	10: 51,627,259	Y169*	probably null	Het
Guca2b	T	C	4: 119,658,804	S18G	unknown	Het
Hars2	A	G	18: 36,789,235	D301G	possibly damaging	Het
Haus5	T	A	7: 30,659,559	Q226L	possibly damaging	Het
Hc	G	A	2: 35,012,898		probably null	Het
Hivep2	T	C	10: 14,128,267	V203A	probably damaging	Het
Hoxc8	A	G	15: 102,991,111	Y111C	probably damaging	Het
Hoxd13	G	T	2: 74,668,317	R3L	probably benign	Het
Hspa8	T	G	9: 40,802,601	I130S	probably damaging	Het
Ier5l	C	A	2: 30,472,849	C388F	possibly damaging	Het
Lmx1a	A	G	1: 167,689,803	N10S	probably benign	Het
Map2	T	C	1: 66,415,113	I1054T	probably benign	Het
Me1	C	T	9: 86,619,737	D268N	probably damaging	Het
Muc6	G	A	7: 141,640,258	P1501S	unknown	Het
Myo1d	T	C	11: 80,638,074	M641V	probably benign	Het
Nuggc	G	A	14: 65,641,282	R667K	probably benign	Het
Olfr62	A	C	4: 118,666,407	N297H	probably damaging	Het
Olfr742	T	C	14: 50,515,558	F118S	probably damaging	Het
Oprl1	T	A	2: 181,718,924	C231S	probably damaging	Het
Pard3b	C	A	1: 62,637,798	Q1163K	probably benign	Het
Pik3c2a	T	C	7: 116,418,048	Y158C	probably damaging	Het
Prune2	T	G	19: 17,121,265	S1378A	probably benign	Het
Ralgps2	G	T	1: 156,884,540	T158K	probably damaging	Het
Rbm42	T	A	7: 30,645,157	E227V	unknown	Het
Ripor3	T	C	2: 167,983,199	R797G	possibly damaging	Het
Ryr3	T	A	2: 112,662,510	H3764L	possibly damaging	Het
Sbno2	T	C	10: 80,064,387	Y541C	probably damaging	Het
Scn5a	A	G	9: 119,535,964	V396A	probably damaging	Het
Slc36a3	A	G	11: 55,148,583	L73P	probably damaging	Het
Spag16	T	C	1: 69,895,248	I278T	probably benign	Het
Stx18	T	A	5: 38,128,106	L274*	probably null	Het
Terb1	A	T	8: 104,484,371	N341K	probably damaging	Het
Timm29	A	G	9: 21,593,705	Y223C	probably damaging	Het
Tmprss2	T	A	16: 97,568,465	M370L	probably benign	Het
Tmtc3	T	A	10: 100,447,434	N753I	probably damaging	Het
Tnpo3	A	T	6: 29,558,833	C699*	probably null	Het
Trav5d-4	G	A	14: 53,001,751	W13*	probably null	Het
Trdn	A	G	10: 33,444,078		probably null	Het
Tsg101	A	T	7: 46,909,060	Y68N	probably damaging	Het
Ttn	A	G	2: 76,833,718	V11649A	unknown	Het
Wnk2	A	T	13: 49,095,438	V379D	probably damaging	Het
Xpnpep1	A	G	19: 53,002,472		probably null	Het
Yme1l1	C	T	2: 23,164,585	Q139*	probably null	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign
R9528:Clptm1l	UTSW	13	73612431	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AAGTGGTGGGTTCCGTAGAC -3'
(R):5'- AGTGAGATTCAGAGATGCTCACTG -3'

Sequencing Primer
(F):5'- GTTCCGTAGACAGTGAACATGTC -3'
(R):5'- GATTCAGAGATGCTCACTGACTGC -3'

Posted On

2020-09-02