Incidental Mutation 'R0068:Gm11639'
ID64428
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0068 (G1)
Quality Score184
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104720822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 497 (S497P)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect unknown
Transcript: ENSMUST00000148007
AA Change: S424P
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: S424P

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175713
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: S497P

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7923:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7929:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7962:Gm11639 UTSW 11 104720636 small deletion probably benign
R7976:Gm11639 UTSW 11 104979360 missense unknown
R7980:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R8031:Gm11639 UTSW 11 104881469 missense not run
R8041:Gm11639 UTSW 11 104919479 missense not run
R8054:Gm11639 UTSW 11 104730400 missense not run
R8056:Gm11639 UTSW 11 104909070 missense not run
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense not run
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense not run
Z1177:Gm11639 UTSW 11 104924019 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGATGAGGCTGAACTTAAACTCTCC -3'
(R):5'- CACTTCTATCCAGTGACTTCTTGAGGC -3'

Sequencing Primer
(F):5'- TCTCAAGTGGGATCATCAGC -3'
(R):5'- GCTTGAATCACGTCTATCCGATAAC -3'
Posted On2013-08-06