Incidental Mutation 'R8329:Cog3'
ID644282
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Namecomponent of oligomeric golgi complex 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8329 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location75702350-75754517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75740563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 230 (D230E)
Ref Sequence ENSEMBL: ENSMUSP00000045016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
Predicted Effect probably damaging
Transcript: ENSMUST00000049168
AA Change: D230E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: D230E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227473
AA Change: D220E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Aff3 G A 1: 38,205,054 R879W probably benign Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hc G A 2: 35,012,898 probably null Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Trdn A G 10: 33,444,078 probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75730604 missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75722196 splice site probably benign
IGL02934:Cog3 APN 14 75741689 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0403:Cog3 UTSW 14 75742327 splice site probably benign
R0972:Cog3 UTSW 14 75717170 missense probably benign
R1735:Cog3 UTSW 14 75729321 nonsense probably null
R1813:Cog3 UTSW 14 75742344 missense probably benign 0.03
R1896:Cog3 UTSW 14 75742344 missense probably benign 0.03
R2517:Cog3 UTSW 14 75741742 missense probably benign 0.01
R2567:Cog3 UTSW 14 75754290 missense probably benign
R2962:Cog3 UTSW 14 75740534 critical splice donor site probably null
R3103:Cog3 UTSW 14 75747201 critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3691:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3927:Cog3 UTSW 14 75743558 splice site probably benign
R4581:Cog3 UTSW 14 75732951 missense probably benign 0.04
R4932:Cog3 UTSW 14 75732954 missense probably damaging 0.98
R5560:Cog3 UTSW 14 75729393 missense probably damaging 1.00
R5654:Cog3 UTSW 14 75724799 missense probably benign 0.03
R6253:Cog3 UTSW 14 75719712 missense probably damaging 1.00
R6419:Cog3 UTSW 14 75724738 nonsense probably null
R6791:Cog3 UTSW 14 75730678 missense probably damaging 1.00
R6803:Cog3 UTSW 14 75704039 missense probably benign 0.00
R7015:Cog3 UTSW 14 75713276 missense possibly damaging 0.81
R7998:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
R7999:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
R8075:Cog3 UTSW 14 75730702 missense probably damaging 1.00
R8294:Cog3 UTSW 14 75717179 missense probably damaging 1.00
R8434:Cog3 UTSW 14 75742396 missense probably damaging 1.00
X0017:Cog3 UTSW 14 75741741 missense probably benign 0.01
X0021:Cog3 UTSW 14 75743593 missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75741741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCAAGGGTAAGAGAGTACTC -3'
(R):5'- GGCCACAGTTGAGGATATTTCAG -3'

Sequencing Primer
(F):5'- CATGACATAGCTGCTATGGGACC -3'
(R):5'- GGATATTTCAGAGATTGTTCAAGGC -3'
Posted On2020-09-02