Incidental Mutation 'R8329:Hoxc8'
ID 644283
Institutional Source Beutler Lab
Gene Symbol Hoxc8
Ensembl Gene ENSMUSG00000001657
Gene Name homeobox C8
Synonyms Hox-3.1, D130011F21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R8329 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102990607-102994111 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102991111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 111 (Y111C)
Ref Sequence ENSEMBL: ENSMUSP00000001703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001703]
AlphaFold P09025
Predicted Effect probably damaging
Transcript: ENSMUST00000001703
AA Change: Y111C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001703
Gene: ENSMUSG00000001657
AA Change: Y111C

DomainStartEndE-ValueType
HOX 149 211 1.63e-26 SMART
coiled coil region 216 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the regulation of cartilage differentiation. It could also be involved in chondrodysplasias or other cartilage disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit abnormal growth and axial skeleton morphology. Mice homozygous for a knock-out allele exhibit postnatal lethality, axial skeletal defects, abnormal growth, and abnormal gait. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Aff3 G A 1: 38,205,054 R879W probably benign Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Cyp2c66 T A 19: 39,186,462 C435* probably null Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hc G A 2: 35,012,898 probably null Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Trdn A G 10: 33,444,078 probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Hoxc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Hoxc8 APN 15 102992593 missense probably damaging 1.00
IGL02458:Hoxc8 APN 15 102992749 missense probably damaging 1.00
R6521:Hoxc8 UTSW 15 102992703 missense probably benign 0.19
R7327:Hoxc8 UTSW 15 102991110 missense probably damaging 1.00
R8930:Hoxc8 UTSW 15 102990886 missense possibly damaging 0.87
R8932:Hoxc8 UTSW 15 102990886 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCACGTCCAAGACTTCTTC -3'
(R):5'- TTTCAATCTCCCAGGAACCC -3'

Sequencing Primer
(F):5'- AGACTTCTTCCACCACGGC -3'
(R):5'- GGAGAGACCCCCAAAGCCAG -3'
Posted On 2020-09-02