Incidental Mutation 'R8329:Cyp2c66'
ID644288
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R8329 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39113898-39187072 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 39186462 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 435 (C435*)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
Predicted Effect probably null
Transcript: ENSMUST00000087234
AA Change: C435*
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: C435*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,543,741 probably null Het
Ackr4 A G 9: 104,099,461 F96L possibly damaging Het
Aco1 T C 4: 40,186,376 I596T possibly damaging Het
Apob A G 12: 8,011,135 R3206G probably damaging Het
Atg7 T A 6: 114,686,096 D224E possibly damaging Het
Capn12 T C 7: 28,883,201 F167S probably damaging Het
Ccdc3 T G 2: 5,229,037 V224G probably damaging Het
Ces4a G A 8: 105,148,082 V452I probably damaging Het
Cherp G A 8: 72,462,008 R834C Het
Clptm1l T A 13: 73,612,428 I310N probably damaging Het
Cog3 A T 14: 75,740,563 D230E probably damaging Het
Crb1 T A 1: 139,237,267 I1101F probably damaging Het
Cts6 A T 13: 61,195,468 M313K probably damaging Het
Defb13 A G 8: 21,948,546 E40G probably benign Het
Dis3l T C 9: 64,311,830 D606G possibly damaging Het
Dopey2 T C 16: 93,771,787 L1579P probably damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gcn1l1 G A 5: 115,609,862 G1776E probably damaging Het
Gls2 A G 10: 128,201,285 T232A probably benign Het
Gm853 C T 4: 130,215,363 V295M possibly damaging Het
Gprc6a A T 10: 51,627,259 Y169* probably null Het
Guca2b T C 4: 119,658,804 S18G unknown Het
Hars2 A G 18: 36,789,235 D301G possibly damaging Het
Haus5 T A 7: 30,659,559 Q226L possibly damaging Het
Hivep2 T C 10: 14,128,267 V203A probably damaging Het
Hoxc8 A G 15: 102,991,111 Y111C probably damaging Het
Hoxd13 G T 2: 74,668,317 R3L probably benign Het
Hspa8 T G 9: 40,802,601 I130S probably damaging Het
Ier5l C A 2: 30,472,849 C388F possibly damaging Het
Lmx1a A G 1: 167,689,803 N10S probably benign Het
Map2 T C 1: 66,415,113 I1054T probably benign Het
Me1 C T 9: 86,619,737 D268N probably damaging Het
Muc6 G A 7: 141,640,258 P1501S unknown Het
Myo1d T C 11: 80,638,074 M641V probably benign Het
Nuggc G A 14: 65,641,282 R667K probably benign Het
Olfr62 A C 4: 118,666,407 N297H probably damaging Het
Olfr742 T C 14: 50,515,558 F118S probably damaging Het
Oprl1 T A 2: 181,718,924 C231S probably damaging Het
Pard3b C A 1: 62,637,798 Q1163K probably benign Het
Pik3c2a T C 7: 116,418,048 Y158C probably damaging Het
Prune2 T G 19: 17,121,265 S1378A probably benign Het
Ralgps2 G T 1: 156,884,540 T158K probably damaging Het
Rbm42 T A 7: 30,645,157 E227V unknown Het
Ripor3 T C 2: 167,983,199 R797G possibly damaging Het
Ryr3 T A 2: 112,662,510 H3764L possibly damaging Het
Sbno2 T C 10: 80,064,387 Y541C probably damaging Het
Scn5a A G 9: 119,535,964 V396A probably damaging Het
Slc36a3 A G 11: 55,148,583 L73P probably damaging Het
Spag16 T C 1: 69,895,248 I278T probably benign Het
Stx18 T A 5: 38,128,106 L274* probably null Het
Terb1 A T 8: 104,484,371 N341K probably damaging Het
Timm29 A G 9: 21,593,705 Y223C probably damaging Het
Tmprss2 T A 16: 97,568,465 M370L probably benign Het
Tmtc3 T A 10: 100,447,434 N753I probably damaging Het
Tnpo3 A T 6: 29,558,833 C699* probably null Het
Trav5d-4 G A 14: 53,001,751 W13* probably null Het
Tsg101 A T 7: 46,909,060 Y68N probably damaging Het
Ttn A G 2: 76,833,718 V11649A unknown Het
Wnk2 A T 13: 49,095,438 V379D probably damaging Het
Xpnpep1 A G 19: 53,002,472 probably null Het
Yme1l1 C T 2: 23,164,585 Q139* probably null Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39170961 missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39183935 critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39171029 missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39171075 splice site probably benign
IGL02567:Cyp2c66 APN 19 39186640 utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39142039 missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39183858 missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39170958 nonsense probably null
R0092:Cyp2c66 UTSW 19 39183780 splice site probably benign
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39176691 missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39186616 missense possibly damaging 0.93
R1127:Cyp2c66 UTSW 19 39163368 missense probably damaging 1.00
R1871:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R3404:Cyp2c66 UTSW 19 39163327 missense probably benign
R3429:Cyp2c66 UTSW 19 39163448 missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39142278 missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4668:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39163399 missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39163322 critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39163470 missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39163438 missense probably benign 0.00
R5125:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5178:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5588:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R6011:Cyp2c66 UTSW 19 39141936 missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39163377 missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39186500 missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39170957 missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39141904 missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39183863 missense probably damaging 1.00
R7614:Cyp2c66 UTSW 19 39171028 missense probably damaging 0.98
R7985:Cyp2c66 UTSW 19 39113986 missense probably null 1.00
R8012:Cyp2c66 UTSW 19 39183925 missense probably damaging 1.00
R8056:Cyp2c66 UTSW 19 39142041 missense probably benign 0.00
R8302:Cyp2c66 UTSW 19 39176634 missense probably damaging 1.00
R8365:Cyp2c66 UTSW 19 39176604 missense probably benign 0.00
R8502:Cyp2c66 UTSW 19 39142329 missense probably benign 0.01
Z1177:Cyp2c66 UTSW 19 39186626 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACGGTATTTCCTAGTATTAGCCATGG -3'
(R):5'- CCTCAAGGAAAGGGCTTTAGGG -3'

Sequencing Primer
(F):5'- GCCATGGAGAAATGTATGTCAATC -3'
(R):5'- CTTTAGGGGGAAATCCATTTAGATG -3'
Posted On2020-09-02