Incidental Mutation 'R8330:Kmt2c'
ID 644300
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, HALR, E330008K23Rik
MMRRC Submission 067799-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8330 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 25476796-25703781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25509692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 3161 (F3161L)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000174734]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000045291
AA Change: F3161L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: F3161L

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172556
AA Change: F79L
SMART Domains Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056
AA Change: F79L

DomainStartEndE-ValueType
SCOP:d2spca_ 84 177 1e-3 SMART
low complexity region 196 209 N/A INTRINSIC
coiled coil region 307 345 N/A INTRINSIC
low complexity region 379 405 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 568 586 N/A INTRINSIC
low complexity region 688 702 N/A INTRINSIC
low complexity region 735 752 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
low complexity region 863 886 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1260 1267 N/A INTRINSIC
PHD 1302 1348 2.94e-2 SMART
FYRN 1402 1445 1.18e-21 SMART
FYRC 1451 1538 4.54e-32 SMART
SET 1608 1730 3.17e-34 SMART
PostSET 1732 1748 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174734
SMART Domains Protein: ENSMUSP00000133482
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 49 75 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 411 416 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
low complexity region 1032 1039 N/A INTRINSIC
PHD 1074 1120 2.94e-2 SMART
FYRN 1174 1217 1.18e-21 SMART
FYRC 1223 1310 4.54e-32 SMART
SET 1384 1506 3.17e-34 SMART
PostSET 1508 1524 1.82e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,381,750 (GRCm39) D1405V probably damaging Het
Acsl6 A G 11: 54,236,034 (GRCm39) I514V probably benign Het
Adgrv1 C T 13: 81,593,462 (GRCm39) R4175H probably damaging Het
Ahnak T C 19: 8,987,026 (GRCm39) V2770A possibly damaging Het
B4galt1 A G 4: 40,812,787 (GRCm39) V246A probably damaging Het
Cdr2l T C 11: 115,284,939 (GRCm39) V425A probably benign Het
Celsr1 T A 15: 85,816,501 (GRCm39) D1814V probably damaging Het
Exoc2 A G 13: 31,061,556 (GRCm39) V495A probably benign Het
Ifi47 A G 11: 48,986,637 (GRCm39) T135A possibly damaging Het
Klhl23 T C 2: 69,654,496 (GRCm39) V122A probably damaging Het
Klri2 T A 6: 129,710,694 (GRCm39) N142Y probably damaging Het
Mgl2 A G 11: 70,026,785 (GRCm39) T144A probably benign Het
Mpp3 T C 11: 101,899,453 (GRCm39) E356G probably benign Het
Neb T G 2: 52,117,420 (GRCm39) T872P Het
Nek9 A G 12: 85,376,727 (GRCm39) M218T probably damaging Het
Or10a49 A T 7: 108,468,046 (GRCm39) L105H probably damaging Het
Or4f14 A G 2: 111,742,724 (GRCm39) F184L probably benign Het
Or51k2 T G 7: 103,596,610 (GRCm39) I279S possibly damaging Het
Pabpc1l G A 2: 163,869,568 (GRCm39) G123R probably damaging Het
Parp3 T C 9: 106,352,069 (GRCm39) probably null Het
Pcdhga1 A T 18: 37,796,376 (GRCm39) Y460F probably benign Het
Pclo A G 5: 14,725,311 (GRCm39) T1390A unknown Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pex6 T C 17: 47,023,060 (GRCm39) L212P possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Ppib T C 9: 65,968,755 (GRCm39) F48L probably damaging Het
Psme4 A G 11: 30,793,583 (GRCm39) E1228G probably benign Het
Ptpdc1 G T 13: 48,751,390 (GRCm39) H37N probably benign Het
Rab31 A T 17: 66,003,269 (GRCm39) I126N possibly damaging Het
Rsad2 A T 12: 26,506,405 (GRCm39) V5E probably benign Het
S1pr3 G A 13: 51,573,173 (GRCm39) S118N probably damaging Het
Sbsn T A 7: 30,451,366 (GRCm39) I127N possibly damaging Het
Scart2 C T 7: 139,876,231 (GRCm39) Q568* probably null Het
Selenoh G T 2: 84,500,691 (GRCm39) Q50K probably damaging Het
Simc1 GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA 13: 54,673,177 (GRCm39) probably benign Het
Stkld1 A T 2: 26,841,515 (GRCm39) I487L probably benign Het
Tep1 T A 14: 51,085,162 (GRCm39) I874F possibly damaging Het
Tmem43 T C 6: 91,455,746 (GRCm39) V119A possibly damaging Het
Vmn2r80 T A 10: 79,007,550 (GRCm39) W509R probably damaging Het
Xpr1 A C 1: 155,189,001 (GRCm39) Y290* probably null Het
Zfp160 T C 17: 21,246,313 (GRCm39) C288R probably damaging Het
Zfp955a C T 17: 33,463,087 (GRCm39) V15M probably damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25,486,259 (GRCm39) missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25,498,159 (GRCm39) missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25,516,049 (GRCm39) missense probably benign 0.00
IGL00811:Kmt2c APN 5 25,579,531 (GRCm39) missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25,614,169 (GRCm39) missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25,582,159 (GRCm39) missense probably benign 0.08
IGL00959:Kmt2c APN 5 25,481,227 (GRCm39) missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25,507,699 (GRCm39) unclassified probably benign
IGL01146:Kmt2c APN 5 25,513,510 (GRCm39) missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25,489,397 (GRCm39) missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25,614,306 (GRCm39) missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25,557,242 (GRCm39) missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25,534,439 (GRCm39) splice site probably benign
IGL01530:Kmt2c APN 5 25,518,498 (GRCm39) missense probably benign 0.08
IGL01550:Kmt2c APN 5 25,486,274 (GRCm39) missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25,478,664 (GRCm39) makesense probably null
IGL01598:Kmt2c APN 5 25,559,769 (GRCm39) missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25,559,809 (GRCm39) missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25,515,668 (GRCm39) missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25,505,096 (GRCm39) missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25,518,398 (GRCm39) missense probably benign
IGL01784:Kmt2c APN 5 25,518,524 (GRCm39) missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25,495,802 (GRCm39) missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25,515,594 (GRCm39) missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25,600,453 (GRCm39) missense probably benign 0.05
IGL02072:Kmt2c APN 5 25,610,430 (GRCm39) missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25,516,341 (GRCm39) missense probably benign 0.18
IGL02303:Kmt2c APN 5 25,515,155 (GRCm39) missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25,578,018 (GRCm39) missense probably benign
IGL02578:Kmt2c APN 5 25,571,198 (GRCm39) intron probably benign
IGL02811:Kmt2c APN 5 25,520,026 (GRCm39) nonsense probably null
IGL02943:Kmt2c APN 5 25,495,821 (GRCm39) missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25,489,170 (GRCm39) missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25,515,350 (GRCm39) missense probably benign
IGL03076:Kmt2c APN 5 25,504,149 (GRCm39) nonsense probably null
IGL03088:Kmt2c APN 5 25,504,802 (GRCm39) missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25,520,359 (GRCm39) missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25,520,764 (GRCm39) small insertion probably benign
FR4976:Kmt2c UTSW 5 25,520,761 (GRCm39) small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25,520,664 (GRCm39) missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25,520,104 (GRCm39) missense probably benign 0.21
R0313:Kmt2c UTSW 5 25,549,928 (GRCm39) missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25,514,706 (GRCm39) missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25,580,955 (GRCm39) missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25,520,662 (GRCm39) missense probably benign
R0453:Kmt2c UTSW 5 25,559,745 (GRCm39) missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25,504,250 (GRCm39) missense probably benign
R0619:Kmt2c UTSW 5 25,503,914 (GRCm39) missense probably benign 0.21
R0671:Kmt2c UTSW 5 25,609,363 (GRCm39) missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25,500,432 (GRCm39) missense probably benign
R0745:Kmt2c UTSW 5 25,564,696 (GRCm39) splice site probably null
R0760:Kmt2c UTSW 5 25,558,315 (GRCm39) missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25,515,893 (GRCm39) missense probably benign 0.00
R0882:Kmt2c UTSW 5 25,500,605 (GRCm39) missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25,556,268 (GRCm39) splice site probably benign
R0942:Kmt2c UTSW 5 25,520,301 (GRCm39) missense probably benign 0.10
R1110:Kmt2c UTSW 5 25,519,360 (GRCm39) missense probably benign 0.01
R1137:Kmt2c UTSW 5 25,515,981 (GRCm39) missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25,556,151 (GRCm39) missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25,610,452 (GRCm39) missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25,519,513 (GRCm39) missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25,519,876 (GRCm39) missense probably benign 0.01
R1611:Kmt2c UTSW 5 25,564,309 (GRCm39) critical splice donor site probably null
R1617:Kmt2c UTSW 5 25,580,925 (GRCm39) missense probably benign 0.01
R1720:Kmt2c UTSW 5 25,504,182 (GRCm39) missense probably benign 0.05
R1723:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25,495,525 (GRCm39) missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25,577,972 (GRCm39) missense probably benign 0.02
R1809:Kmt2c UTSW 5 25,489,190 (GRCm39) missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25,578,434 (GRCm39) missense probably benign 0.45
R1895:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1946:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1989:Kmt2c UTSW 5 25,703,542 (GRCm39) missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25,534,038 (GRCm39) missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25,490,077 (GRCm39) missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25,557,278 (GRCm39) missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25,559,715 (GRCm39) missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25,514,822 (GRCm39) missense probably benign 0.01
R2186:Kmt2c UTSW 5 25,492,110 (GRCm39) missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25,520,150 (GRCm39) missense probably benign
R2983:Kmt2c UTSW 5 25,520,755 (GRCm39) small deletion probably benign
R3109:Kmt2c UTSW 5 25,480,733 (GRCm39) missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25,504,477 (GRCm39) missense probably benign 0.02
R3738:Kmt2c UTSW 5 25,610,381 (GRCm39) missense probably benign 0.41
R3809:Kmt2c UTSW 5 25,614,136 (GRCm39) missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25,492,711 (GRCm39) missense probably benign
R4107:Kmt2c UTSW 5 25,503,918 (GRCm39) missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25,552,357 (GRCm39) critical splice donor site probably null
R4376:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4377:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4383:Kmt2c UTSW 5 25,556,060 (GRCm39) missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25,519,875 (GRCm39) missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25,515,210 (GRCm39) missense probably benign
R4461:Kmt2c UTSW 5 25,504,874 (GRCm39) missense probably benign 0.00
R4519:Kmt2c UTSW 5 25,568,475 (GRCm39) missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25,505,172 (GRCm39) missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25,505,313 (GRCm39) missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25,559,382 (GRCm39) missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25,571,175 (GRCm39) missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25,519,025 (GRCm39) nonsense probably null
R4781:Kmt2c UTSW 5 25,648,823 (GRCm39) missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25,520,111 (GRCm39) missense probably benign
R4855:Kmt2c UTSW 5 25,519,555 (GRCm39) missense probably benign 0.00
R4919:Kmt2c UTSW 5 25,519,393 (GRCm39) missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25,515,870 (GRCm39) missense probably benign 0.00
R4983:Kmt2c UTSW 5 25,500,509 (GRCm39) missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25,504,710 (GRCm39) nonsense probably null
R5033:Kmt2c UTSW 5 25,519,706 (GRCm39) missense probably benign 0.03
R5093:Kmt2c UTSW 5 25,614,205 (GRCm39) missense probably benign 0.17
R5125:Kmt2c UTSW 5 25,489,379 (GRCm39) missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25,520,471 (GRCm39) missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25,519,592 (GRCm39) missense probably benign 0.01
R5396:Kmt2c UTSW 5 25,499,732 (GRCm39) splice site probably null
R5415:Kmt2c UTSW 5 25,519,699 (GRCm39) missense probably benign 0.21
R5523:Kmt2c UTSW 5 25,504,337 (GRCm39) missense probably benign 0.00
R5554:Kmt2c UTSW 5 25,499,608 (GRCm39) missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25,519,015 (GRCm39) missense probably benign 0.16
R5762:Kmt2c UTSW 5 25,515,455 (GRCm39) missense probably benign 0.01
R5819:Kmt2c UTSW 5 25,614,130 (GRCm39) critical splice donor site probably null
R5838:Kmt2c UTSW 5 25,489,469 (GRCm39) missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25,552,467 (GRCm39) missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25,535,801 (GRCm39) missense probably benign 0.15
R5988:Kmt2c UTSW 5 25,516,118 (GRCm39) missense probably benign 0.02
R5999:Kmt2c UTSW 5 25,489,203 (GRCm39) missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25,504,127 (GRCm39) missense probably benign
R6254:Kmt2c UTSW 5 25,554,872 (GRCm39) missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25,648,816 (GRCm39) critical splice donor site probably null
R6329:Kmt2c UTSW 5 25,520,600 (GRCm39) missense probably benign 0.01
R6347:Kmt2c UTSW 5 25,515,833 (GRCm39) missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25,514,634 (GRCm39) missense probably null 0.99
R6379:Kmt2c UTSW 5 25,564,339 (GRCm39) missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25,528,787 (GRCm39) missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25,503,926 (GRCm39) missense probably benign
R6733:Kmt2c UTSW 5 25,614,291 (GRCm39) missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25,480,737 (GRCm39) splice site probably null
R6816:Kmt2c UTSW 5 25,610,530 (GRCm39) splice site probably null
R6862:Kmt2c UTSW 5 25,515,515 (GRCm39) missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25,505,360 (GRCm39) missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25,549,923 (GRCm39) missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25,514,805 (GRCm39) missense probably benign 0.00
R7250:Kmt2c UTSW 5 25,504,489 (GRCm39) missense probably damaging 1.00
R7402:Kmt2c UTSW 5 25,600,418 (GRCm39) missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25,507,847 (GRCm39) missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25,513,530 (GRCm39) missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25,489,562 (GRCm39) missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25,619,968 (GRCm39) missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25,520,093 (GRCm39) missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25,520,717 (GRCm39) missense probably benign 0.01
R7714:Kmt2c UTSW 5 25,580,364 (GRCm39) missense probably benign
R7838:Kmt2c UTSW 5 25,499,697 (GRCm39) missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25,505,109 (GRCm39) missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25,504,814 (GRCm39) missense probably benign 0.18
R7895:Kmt2c UTSW 5 25,578,174 (GRCm39) missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25,520,194 (GRCm39) missense probably benign 0.01
R7974:Kmt2c UTSW 5 25,505,561 (GRCm39) missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25,564,676 (GRCm39) missense probably benign 0.00
R8011:Kmt2c UTSW 5 25,556,232 (GRCm39) missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25,492,117 (GRCm39) missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25,486,678 (GRCm39) missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25,507,730 (GRCm39) missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25,534,250 (GRCm39) missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25,486,382 (GRCm39) missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25,579,562 (GRCm39) missense probably benign 0.00
R8169:Kmt2c UTSW 5 25,559,685 (GRCm39) missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25,519,537 (GRCm39) missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25,488,104 (GRCm39) missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25,529,216 (GRCm39) missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25,610,514 (GRCm39) missense possibly damaging 0.87
R8355:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25,519,120 (GRCm39) missense probably benign 0.34
R8885:Kmt2c UTSW 5 25,520,077 (GRCm39) missense probably benign 0.34
R8907:Kmt2c UTSW 5 25,514,609 (GRCm39) missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25,503,885 (GRCm39) missense probably benign
R8969:Kmt2c UTSW 5 25,519,387 (GRCm39) missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25,488,208 (GRCm39) missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25,524,010 (GRCm39) missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25,489,343 (GRCm39) missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25,489,194 (GRCm39) missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25,516,102 (GRCm39) missense probably benign 0.01
R9171:Kmt2c UTSW 5 25,486,309 (GRCm39) missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25,504,997 (GRCm39) missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9288:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9336:Kmt2c UTSW 5 25,614,165 (GRCm39) missense probably benign 0.06
R9443:Kmt2c UTSW 5 25,515,045 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9526:Kmt2c UTSW 5 25,486,355 (GRCm39) missense probably damaging 1.00
R9653:Kmt2c UTSW 5 25,507,819 (GRCm39) missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25,489,758 (GRCm39) missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25,577,956 (GRCm39) missense probably benign 0.18
R9784:Kmt2c UTSW 5 25,549,959 (GRCm39) missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF006:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF011:Kmt2c UTSW 5 25,543,457 (GRCm39) missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF047:Kmt2c UTSW 5 25,520,758 (GRCm39) small insertion probably benign
RF051:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF055:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF059:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF063:Kmt2c UTSW 5 25,520,762 (GRCm39) small insertion probably benign
X0024:Kmt2c UTSW 5 25,610,483 (GRCm39) missense probably benign 0.26
X0027:Kmt2c UTSW 5 25,535,885 (GRCm39) missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25,559,411 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25,571,195 (GRCm39) critical splice acceptor site probably null
Z1177:Kmt2c UTSW 5 25,505,001 (GRCm39) missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25,500,395 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGAAAACACATGCCTTGCTG -3'
(R):5'- GTTCTGGCCAGGAAATTGTG -3'

Sequencing Primer
(F):5'- CCTTGCTGTAAAGATGCCTAGGAC -3'
(R):5'- GCCAGGAAATTGTGAAATTATCAGC -3'
Posted On 2020-09-02