Incidental Mutation 'R8330:5830411N06Rik'
ID 644307
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8330 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 140296318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 568 (Q568*)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably null
Transcript: ENSMUST00000093984
AA Change: Q452*
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: Q452*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164583
AA Change: Q568*
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: Q568*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,659,793 D1405V probably damaging Het
Acsl6 A G 11: 54,345,208 I514V probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahnak T C 19: 9,009,662 V2770A possibly damaging Het
B4galt1 A G 4: 40,812,787 V246A probably damaging Het
Cdr2l T C 11: 115,394,113 V425A probably benign Het
Celsr1 T A 15: 85,932,300 D1814V probably damaging Het
Exoc2 A G 13: 30,877,573 V495A probably benign Het
Ifi47 A G 11: 49,095,810 T135A possibly damaging Het
Klhl23 T C 2: 69,824,152 V122A probably damaging Het
Klri2 T A 6: 129,733,731 N142Y probably damaging Het
Kmt2c A T 5: 25,304,694 F3161L probably null Het
Mgl2 A G 11: 70,135,959 T144A probably benign Het
Mpp3 T C 11: 102,008,627 E356G probably benign Het
Neb T G 2: 52,227,408 T872P Het
Nek9 A G 12: 85,329,953 M218T probably damaging Het
Olfr1306 A G 2: 111,912,379 F184L probably benign Het
Olfr517 A T 7: 108,868,839 L105H probably damaging Het
Olfr633 T G 7: 103,947,403 I279S possibly damaging Het
Pabpc1l G A 2: 164,027,648 G123R probably damaging Het
Parp3 T C 9: 106,474,870 probably null Het
Pcdhga1 A T 18: 37,663,323 Y460F probably benign Het
Pclo A G 5: 14,675,297 T1390A unknown Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pex6 T C 17: 46,712,134 L212P possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppib T C 9: 66,061,473 F48L probably damaging Het
Psme4 A G 11: 30,843,583 E1228G probably benign Het
Ptpdc1 G T 13: 48,597,914 H37N probably benign Het
Rab31 A T 17: 65,696,274 I126N possibly damaging Het
Rsad2 A T 12: 26,456,406 V5E probably benign Het
S1pr3 G A 13: 51,419,137 S118N probably damaging Het
Sbsn T A 7: 30,751,941 I127N possibly damaging Het
Selenoh G T 2: 84,670,347 Q50K probably damaging Het
Simc1 GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA 13: 54,525,364 probably benign Het
Stkld1 A T 2: 26,951,503 I487L probably benign Het
Tep1 T A 14: 50,847,705 I874F possibly damaging Het
Tmem43 T C 6: 91,478,764 V119A possibly damaging Het
Vmn2r80 T A 10: 79,171,716 W509R probably damaging Het
Xpr1 A C 1: 155,313,255 Y290* probably null Het
Zfp160 T C 17: 21,026,051 C288R probably damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTGAGCTGCCCAACAAGC -3'
(R):5'- CAGGAATGGTCTTATGGCCTG -3'

Sequencing Primer
(F):5'- ATGCGCACTGGGGAATTC -3'
(R):5'- CTTATGGCCTGGTGCTGGC -3'
Posted On 2020-09-02