Incidental Mutation 'R8330:5830411N06Rik'
ID644307
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene NameRIKEN cDNA 5830411N06 gene
SynonymsScart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8330 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140247284-140300736 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 140296318 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 568 (Q568*)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
Predicted Effect probably null
Transcript: ENSMUST00000093984
AA Change: Q452*
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: Q452*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164583
AA Change: Q568*
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: Q568*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,659,793 D1405V probably damaging Het
Acsl6 A G 11: 54,345,208 I514V probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahnak T C 19: 9,009,662 V2770A possibly damaging Het
B4galt1 A G 4: 40,812,787 V246A probably damaging Het
Cdr2l T C 11: 115,394,113 V425A probably benign Het
Celsr1 T A 15: 85,932,300 D1814V probably damaging Het
Exoc2 A G 13: 30,877,573 V495A probably benign Het
Ifi47 A G 11: 49,095,810 T135A possibly damaging Het
Klhl23 T C 2: 69,824,152 V122A probably damaging Het
Klri2 T A 6: 129,733,731 N142Y probably damaging Het
Kmt2c A T 5: 25,304,694 F3161L probably null Het
Mgl2 A G 11: 70,135,959 T144A probably benign Het
Mpp3 T C 11: 102,008,627 E356G probably benign Het
Neb T G 2: 52,227,408 T872P Het
Nek9 A G 12: 85,329,953 M218T probably damaging Het
Olfr1306 A G 2: 111,912,379 F184L probably benign Het
Olfr517 A T 7: 108,868,839 L105H probably damaging Het
Olfr633 T G 7: 103,947,403 I279S possibly damaging Het
Pabpc1l G A 2: 164,027,648 G123R probably damaging Het
Parp3 T C 9: 106,474,870 probably null Het
Pcdhga1 A T 18: 37,663,323 Y460F probably benign Het
Pclo A G 5: 14,675,297 T1390A unknown Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pex6 T C 17: 46,712,134 L212P possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppib T C 9: 66,061,473 F48L probably damaging Het
Psme4 A G 11: 30,843,583 E1228G probably benign Het
Ptpdc1 G T 13: 48,597,914 H37N probably benign Het
Rab31 A T 17: 65,696,274 I126N possibly damaging Het
Rsad2 A T 12: 26,456,406 V5E probably benign Het
S1pr3 G A 13: 51,419,137 S118N probably damaging Het
Sbsn T A 7: 30,751,941 I127N possibly damaging Het
Selenoh G T 2: 84,670,347 Q50K probably damaging Het
Simc1 GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA 13: 54,525,364 probably benign Het
Stkld1 A T 2: 26,951,503 I487L probably benign Het
Tep1 T A 14: 50,847,705 I874F possibly damaging Het
Tmem43 T C 6: 91,478,764 V119A possibly damaging Het
Vmn2r80 T A 10: 79,171,716 W509R probably damaging Het
Xpr1 A C 1: 155,313,255 Y290* probably null Het
Zfp160 T C 17: 21,026,051 C288R probably damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTACTGAGCTGCCCAACAAGC -3'
(R):5'- CAGGAATGGTCTTATGGCCTG -3'

Sequencing Primer
(F):5'- ATGCGCACTGGGGAATTC -3'
(R):5'- CTTATGGCCTGGTGCTGGC -3'
Posted On2020-09-02