Incidental Mutation 'R0068:Aldoart2'
ID64431
Institutional Source Beutler Lab
Gene Symbol Aldoart2
Ensembl Gene ENSMUSG00000063129
Gene Namealdolase 1 A, retrogene 2
Synonyms4933425L11Rik, Aldo1-ps1, Aldoa-ps1
MMRRC Submission 038359-MU
Accession Numbers

Ncbi RefSeq: NR_003959.2; MGI:1931052

Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R0068 (G1)
Quality Score177
Status Validated
Chromosome12
Chromosomal Location55565239-55566896 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 55565448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 53 (E53*)
Ref Sequence ENSEMBL: ENSMUSP00000079022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080123]
Predicted Effect probably null
Transcript: ENSMUST00000080123
AA Change: E53*
SMART Domains Protein: ENSMUSP00000079022
Gene: ENSMUSG00000063129
AA Change: E53*

DomainStartEndE-ValueType
Pfam:Glycolytic 15 364 2.3e-191 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Aldoart2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Aldoart2 APN 12 55566135 missense probably benign
IGL01432:Aldoart2 APN 12 55565781 missense probably damaging 1.00
IGL02306:Aldoart2 APN 12 55565704 missense probably damaging 1.00
R0068:Aldoart2 UTSW 12 55565448 nonsense probably null
R1511:Aldoart2 UTSW 12 55566277 missense probably benign 0.32
R1604:Aldoart2 UTSW 12 55565620 missense probably damaging 1.00
R1622:Aldoart2 UTSW 12 55565911 missense probably benign 0.12
R3729:Aldoart2 UTSW 12 55566319 missense probably damaging 1.00
R4881:Aldoart2 UTSW 12 55566114 missense probably damaging 1.00
R4946:Aldoart2 UTSW 12 55566016 missense probably benign 0.00
R4995:Aldoart2 UTSW 12 55566253 missense probably benign
R5215:Aldoart2 UTSW 12 55565419 missense probably benign 0.25
R5407:Aldoart2 UTSW 12 55566196 missense probably damaging 1.00
R5729:Aldoart2 UTSW 12 55565905 missense probably benign 0.41
R5744:Aldoart2 UTSW 12 55565346 missense possibly damaging 0.52
R7609:Aldoart2 UTSW 12 55566048 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGCAGCATTCGCTCCACAGTTCTC -3'
(R):5'- TCCAGACAGATCATCCAGCCCTTG -3'

Sequencing Primer
(F):5'- AGGACGGCGCTACTACTAC -3'
(R):5'- GCCGTTAGTTCCTGCCAG -3'
Posted On2013-08-06