Incidental Mutation 'R0068:Ankra2'
ID64432
Institutional Source Beutler Lab
Gene Symbol Ankra2
Ensembl Gene ENSMUSG00000021661
Gene Nameankyrin repeat, family A (RFXANK-like), 2
Synonyms
MMRRC Submission 038359-MU
Accession Numbers

Ncbi RefSeq: NM_001271388.1, NM_001271389.1, NM_001271390.1, NM_023472.2, NM_001271391.1, NM_001271392.1; MGI: 1915808

Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0068 (G1)
Quality Score99
Status Validated
Chromosome13
Chromosomal Location98263074-98274754 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 98273383 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 137 (Q137*)
Ref Sequence ENSEMBL: ENSMUSP00000153417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
Predicted Effect probably null
Transcript: ENSMUST00000022164
AA Change: Q297*
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661
AA Change: Q297*

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091356
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123924
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150352
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150916
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155629
Predicted Effect probably null
Transcript: ENSMUST00000226100
AA Change: Q137*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppil1 A T 17: 29,252,256 F92I probably damaging Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Ankra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Ankra2 APN 13 98273374 splice site probably benign
IGL02807:Ankra2 APN 13 98271742 missense probably damaging 1.00
IGL03030:Ankra2 APN 13 98273373 splice site probably benign
R0068:Ankra2 UTSW 13 98273383 nonsense probably null
R0302:Ankra2 UTSW 13 98271692 missense probably damaging 1.00
R0499:Ankra2 UTSW 13 98266454 missense probably damaging 1.00
R0729:Ankra2 UTSW 13 98271727 missense probably damaging 1.00
R1848:Ankra2 UTSW 13 98271124 missense probably damaging 1.00
R2185:Ankra2 UTSW 13 98266404 missense probably damaging 0.99
R2230:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R2232:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R3898:Ankra2 UTSW 13 98273809 missense probably benign 0.13
R4605:Ankra2 UTSW 13 98266234 intron probably benign
R4855:Ankra2 UTSW 13 98273411 missense probably damaging 1.00
R5806:Ankra2 UTSW 13 98268497 critical splice donor site probably null
R5901:Ankra2 UTSW 13 98271136 missense probably damaging 0.99
R6478:Ankra2 UTSW 13 98268442 missense probably damaging 1.00
R7469:Ankra2 UTSW 13 98266374 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCAGATGGCGACAATCAGTCC -3'
(R):5'- GCCCTGTGCAAAGTCAAAAGAGTG -3'

Sequencing Primer
(F):5'- TGGCGACAATCAGTCCTAACAG -3'
(R):5'- CCTGTACCATAAAAGGTTACATGC -3'
Posted On2013-08-06