Incidental Mutation 'R8330:3425401B19Rik'
ID644324
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8330 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32659793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1405 (D1405V)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably damaging
Transcript: ENSMUST00000096038
AA Change: D1405V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: D1405V

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C T 7: 140,296,318 Q568* probably null Het
Acsl6 A G 11: 54,345,208 I514V probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahnak T C 19: 9,009,662 V2770A possibly damaging Het
B4galt1 A G 4: 40,812,787 V246A probably damaging Het
Cdr2l T C 11: 115,394,113 V425A probably benign Het
Celsr1 T A 15: 85,932,300 D1814V probably damaging Het
Exoc2 A G 13: 30,877,573 V495A probably benign Het
Ifi47 A G 11: 49,095,810 T135A possibly damaging Het
Klhl23 T C 2: 69,824,152 V122A probably damaging Het
Klri2 T A 6: 129,733,731 N142Y probably damaging Het
Kmt2c A T 5: 25,304,694 F3161L probably null Het
Mgl2 A G 11: 70,135,959 T144A probably benign Het
Mpp3 T C 11: 102,008,627 E356G probably benign Het
Neb T G 2: 52,227,408 T872P Het
Nek9 A G 12: 85,329,953 M218T probably damaging Het
Olfr1306 A G 2: 111,912,379 F184L probably benign Het
Olfr517 A T 7: 108,868,839 L105H probably damaging Het
Olfr633 T G 7: 103,947,403 I279S possibly damaging Het
Pabpc1l G A 2: 164,027,648 G123R probably damaging Het
Parp3 T C 9: 106,474,870 probably null Het
Pcdhga1 A T 18: 37,663,323 Y460F probably benign Het
Pclo A G 5: 14,675,297 T1390A unknown Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pex6 T C 17: 46,712,134 L212P possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppib T C 9: 66,061,473 F48L probably damaging Het
Psme4 A G 11: 30,843,583 E1228G probably benign Het
Ptpdc1 G T 13: 48,597,914 H37N probably benign Het
Rab31 A T 17: 65,696,274 I126N possibly damaging Het
Rsad2 A T 12: 26,456,406 V5E probably benign Het
S1pr3 G A 13: 51,419,137 S118N probably damaging Het
Sbsn T A 7: 30,751,941 I127N possibly damaging Het
Selenoh G T 2: 84,670,347 Q50K probably damaging Het
Simc1 GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA 13: 54,525,364 probably benign Het
Stkld1 A T 2: 26,951,503 I487L probably benign Het
Tep1 T A 14: 50,847,705 I874F possibly damaging Het
Tmem43 T C 6: 91,478,764 V119A possibly damaging Het
Vmn2r80 T A 10: 79,171,716 W509R probably damaging Het
Xpr1 A C 1: 155,313,255 Y290* probably null Het
Zfp160 T C 17: 21,026,051 C288R probably damaging Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGGACTATAGGGATCTCAAATGGC -3'
(R):5'- CTTTCTCAGGCAGGGTTCTG -3'

Sequencing Primer
(F):5'- TAGGGATCTCAAATGGCTAAGTATG -3'
(R):5'- GCAGGGTTCTGGCCATAG -3'
Posted On2020-09-02