Incidental Mutation 'R8330:Zfp160'
ID 644327
Institutional Source Beutler Lab
Gene Symbol Zfp160
Ensembl Gene ENSMUSG00000067942
Gene Name zinc finger protein 160
Synonyms 6720480D16Rik, 6720480D16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8330 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 21008903-21043070 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21026051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 288 (C288R)
Ref Sequence ENSEMBL: ENSMUSP00000086191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088811] [ENSMUST00000231482] [ENSMUST00000232320] [ENSMUST00000232354] [ENSMUST00000232473] [ENSMUST00000232595] [ENSMUST00000232663]
AlphaFold E9Q459
Predicted Effect probably damaging
Transcript: ENSMUST00000088811
AA Change: C288R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086191
Gene: ENSMUSG00000067942
AA Change: C288R

DomainStartEndE-ValueType
KRAB 8 68 1.91e-29 SMART
low complexity region 100 110 N/A INTRINSIC
ZnF_C2H2 146 168 1.69e-3 SMART
ZnF_C2H2 174 196 2.91e-2 SMART
ZnF_C2H2 202 224 1.4e-4 SMART
ZnF_C2H2 230 252 3.89e-3 SMART
ZnF_C2H2 258 280 1.72e-4 SMART
ZnF_C2H2 286 308 4.94e-5 SMART
ZnF_C2H2 314 336 2.12e-4 SMART
ZnF_C2H2 342 364 1.12e-3 SMART
ZnF_C2H2 370 392 1.2e-3 SMART
ZnF_C2H2 398 420 6.42e-4 SMART
ZnF_C2H2 426 448 9.08e-4 SMART
ZnF_C2H2 454 476 1.84e-4 SMART
ZnF_C2H2 482 504 1.5e-4 SMART
ZnF_C2H2 510 532 3.44e-4 SMART
ZnF_C2H2 538 560 1.12e-3 SMART
ZnF_C2H2 566 588 2.27e-4 SMART
ZnF_C2H2 594 616 1.04e-3 SMART
ZnF_C2H2 622 644 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231482
Predicted Effect probably benign
Transcript: ENSMUST00000232320
Predicted Effect probably benign
Transcript: ENSMUST00000232354
Predicted Effect probably benign
Transcript: ENSMUST00000232473
Predicted Effect probably benign
Transcript: ENSMUST00000232595
Predicted Effect probably benign
Transcript: ENSMUST00000232663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,659,793 D1405V probably damaging Het
5830411N06Rik C T 7: 140,296,318 Q568* probably null Het
Acsl6 A G 11: 54,345,208 I514V probably benign Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ahnak T C 19: 9,009,662 V2770A possibly damaging Het
B4galt1 A G 4: 40,812,787 V246A probably damaging Het
Cdr2l T C 11: 115,394,113 V425A probably benign Het
Celsr1 T A 15: 85,932,300 D1814V probably damaging Het
Exoc2 A G 13: 30,877,573 V495A probably benign Het
Ifi47 A G 11: 49,095,810 T135A possibly damaging Het
Klhl23 T C 2: 69,824,152 V122A probably damaging Het
Klri2 T A 6: 129,733,731 N142Y probably damaging Het
Kmt2c A T 5: 25,304,694 F3161L probably null Het
Mgl2 A G 11: 70,135,959 T144A probably benign Het
Mpp3 T C 11: 102,008,627 E356G probably benign Het
Neb T G 2: 52,227,408 T872P Het
Nek9 A G 12: 85,329,953 M218T probably damaging Het
Olfr1306 A G 2: 111,912,379 F184L probably benign Het
Olfr517 A T 7: 108,868,839 L105H probably damaging Het
Olfr633 T G 7: 103,947,403 I279S possibly damaging Het
Pabpc1l G A 2: 164,027,648 G123R probably damaging Het
Parp3 T C 9: 106,474,870 probably null Het
Pcdhga1 A T 18: 37,663,323 Y460F probably benign Het
Pclo A G 5: 14,675,297 T1390A unknown Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pex6 T C 17: 46,712,134 L212P possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppib T C 9: 66,061,473 F48L probably damaging Het
Psme4 A G 11: 30,843,583 E1228G probably benign Het
Ptpdc1 G T 13: 48,597,914 H37N probably benign Het
Rab31 A T 17: 65,696,274 I126N possibly damaging Het
Rsad2 A T 12: 26,456,406 V5E probably benign Het
S1pr3 G A 13: 51,419,137 S118N probably damaging Het
Sbsn T A 7: 30,751,941 I127N possibly damaging Het
Selenoh G T 2: 84,670,347 Q50K probably damaging Het
Simc1 GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA 13: 54,525,364 probably benign Het
Stkld1 A T 2: 26,951,503 I487L probably benign Het
Tep1 T A 14: 50,847,705 I874F possibly damaging Het
Tmem43 T C 6: 91,478,764 V119A possibly damaging Het
Vmn2r80 T A 10: 79,171,716 W509R probably damaging Het
Xpr1 A C 1: 155,313,255 Y290* probably null Het
Zfp955a C T 17: 33,244,113 V15M probably damaging Het
Other mutations in Zfp160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Zfp160 APN 17 21026702 missense probably benign
IGL01019:Zfp160 APN 17 21020826 missense possibly damaging 0.68
IGL02430:Zfp160 APN 17 21025530 missense possibly damaging 0.76
R0412:Zfp160 UTSW 17 21026877 missense probably damaging 0.97
R0600:Zfp160 UTSW 17 21027006 missense probably benign 0.00
R2146:Zfp160 UTSW 17 21026982 missense probably benign 0.13
R2157:Zfp160 UTSW 17 21020828 missense probably benign 0.23
R2411:Zfp160 UTSW 17 21025745 missense possibly damaging 0.94
R2904:Zfp160 UTSW 17 21025649 missense probably benign 0.00
R4249:Zfp160 UTSW 17 21025738 missense probably benign 0.11
R4896:Zfp160 UTSW 17 21020081 missense probably benign 0.00
R5106:Zfp160 UTSW 17 21026761 missense probably damaging 0.99
R5342:Zfp160 UTSW 17 21020733 missense possibly damaging 0.95
R5352:Zfp160 UTSW 17 21026852 missense probably benign 0.02
R6193:Zfp160 UTSW 17 21026862 missense probably benign 0.24
R6230:Zfp160 UTSW 17 21026445 missense probably benign 0.38
R6753:Zfp160 UTSW 17 21020734 missense probably benign 0.02
R6928:Zfp160 UTSW 17 21041462 missense probably benign 0.04
R7040:Zfp160 UTSW 17 21026532 missense probably damaging 1.00
R7255:Zfp160 UTSW 17 21025487 missense probably benign 0.18
R7497:Zfp160 UTSW 17 21026193 missense probably benign 0.08
R7510:Zfp160 UTSW 17 21026393 missense probably benign 0.00
R7540:Zfp160 UTSW 17 21025660 nonsense probably null
R7627:Zfp160 UTSW 17 21027008 missense probably damaging 0.99
R8169:Zfp160 UTSW 17 21027036 missense probably damaging 0.97
R8240:Zfp160 UTSW 17 21026088 missense probably damaging 0.99
R8367:Zfp160 UTSW 17 21025542 missense probably benign 0.22
R8802:Zfp160 UTSW 17 21026605 missense probably damaging 1.00
R9183:Zfp160 UTSW 17 21020092 missense possibly damaging 0.84
Z1177:Zfp160 UTSW 17 21026890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGCAAGGTGTTCAGT -3'
(R):5'- AGTTTGCCACATTCTTCACACTT -3'

Sequencing Primer
(F):5'- GGTGTTCAGTCAGAATTCACACC -3'
(R):5'- TTGAGTGAAGACCTTGCCAC -3'
Posted On 2020-09-02