Incidental Mutation 'R8331:Tatdn3'
ID644334
Institutional Source Beutler Lab
Gene Symbol Tatdn3
Ensembl Gene ENSMUSG00000026632
Gene NameTatD DNase domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8331 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location191045826-191062932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191046211 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 261 (L261Q)
Ref Sequence ENSEMBL: ENSMUSP00000106518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000077889] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000192151]
Predicted Effect probably damaging
Transcript: ENSMUST00000027945
AA Change: L260Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632
AA Change: L260Q

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077889
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110893
AA Change: L261Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632
AA Change: L261Q

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192151
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,603,952 A545S probably damaging Het
Alox12e A T 11: 70,321,097 S195R probably benign Het
Angpt1 T C 15: 42,676,257 R69G probably damaging Het
Apob A G 12: 8,001,882 Q1149R probably benign Het
Arntl C A 7: 113,313,496 N586K probably benign Het
As3mt A T 19: 46,709,006 E71V probably damaging Het
Atp9a A T 2: 168,675,297 V372E probably benign Het
Bmp2k T C 5: 97,045,069 F259S probably damaging Het
Cacna1c T C 6: 118,630,329 T1364A Het
Casp7 T A 19: 56,440,965 I261N probably damaging Het
Ccdc151 C T 9: 21,991,711 R441H probably damaging Het
Ccdc154 A G 17: 25,167,953 K319E probably benign Het
Cdc42bpg C A 19: 6,313,447 L446I probably benign Het
Cdkl3 A T 11: 52,026,877 T334S probably benign Het
Cep250 T A 2: 155,990,253 L1366Q probably damaging Het
Chp2 G A 7: 122,221,910 D165N probably damaging Het
Ckap5 T A 2: 91,576,200 M782K probably damaging Het
Col20a1 T A 2: 180,996,766 I433N possibly damaging Het
Col4a2 A T 8: 11,413,985 R320* probably null Het
Ctsc A G 7: 88,297,120 H119R possibly damaging Het
Cubn T C 2: 13,340,242 H2121R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
D630045J12Rik T C 6: 38,148,474 E1535G probably damaging Het
Dido1 A T 2: 180,660,449 D1887E probably benign Het
Dnah6 T C 6: 73,025,000 E3903G probably benign Het
Ep300 T C 15: 81,601,210 S133P unknown Het
Ercc3 T C 18: 32,240,818 S73P probably damaging Het
Fis1 T C 5: 136,963,133 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm17087 A G 17: 8,566,707 W55R probably damaging Het
Gm3404 A T 5: 146,525,949 S41C probably damaging Het
Gm5580 T C 6: 116,552,362 I400T probably damaging Het
Greb1l T C 18: 10,458,706 S96P possibly damaging Het
Irf3 C T 7: 45,000,959 P300S probably damaging Het
Klk1b4 G A 7: 44,211,575 C214Y probably damaging Het
Krtap5-3 T A 7: 142,201,826 C133* probably null Het
Map3k12 T A 15: 102,502,331 R448* probably null Het
Map4k2 C G 19: 6,352,823 A738G probably damaging Het
Matn2 A T 15: 34,428,681 K730N probably damaging Het
N4bp2 T A 5: 65,807,600 D997E probably damaging Het
Nav2 C T 7: 49,452,623 P390S probably benign Het
Nme8 A G 13: 19,658,866 S380P probably damaging Het
Nup210 C T 6: 91,053,666 D878N possibly damaging Het
Olfr1299 A G 2: 111,664,382 D52G possibly damaging Het
Olfr896-ps1 A G 9: 38,292,085 I47V possibly damaging Het
Osbpl9 C A 4: 109,066,181 W427L probably damaging Het
Pcdhb12 T C 18: 37,437,289 V496A probably damaging Het
Pdlim1 G A 19: 40,230,551 T212I possibly damaging Het
Phc2 C T 4: 128,712,194 Q270* probably null Het
Pi4kb G A 3: 94,996,684 R527Q probably null Het
Platr25 G T 13: 62,700,903 H48Q probably benign Het
Polr1a C T 6: 71,976,179 T1577M probably damaging Het
Ptprf C T 4: 118,226,066 V915M probably benign Het
Ptprh A G 7: 4,549,481 L928S probably damaging Het
Qrsl1 T C 10: 43,876,525 N434S probably damaging Het
Slc44a4 T A 17: 34,921,569 L246H probably damaging Het
Steap3 A T 1: 120,241,488 C360S possibly damaging Het
Stk10 A G 11: 32,588,928 T256A Het
Thnsl1 T A 2: 21,212,174 F246L probably benign Het
Thsd7a A G 6: 12,471,158 V487A Het
Tmem41a A C 16: 21,947,366 probably null Het
Togaram2 G A 17: 71,729,226 V924M probably damaging Het
Trabd T C 15: 89,084,928 F185S probably damaging Het
Traf1 T C 2: 34,948,358 D156G probably damaging Het
Ttn T C 2: 76,880,138 E8513G unknown Het
Txlna C A 4: 129,639,486 S83I probably damaging Het
Utrn T G 10: 12,614,619 T6P probably benign Het
Vmn2r26 T A 6: 124,061,928 S821T probably benign Het
Wnk1 T C 6: 119,953,833 I917V probably benign Het
Wscd2 A G 5: 113,550,935 M1V probably null Het
Xkr6 A G 14: 63,818,943 H357R unknown Het
Zfhx2 G T 14: 55,071,987 T885K probably benign Het
Zfp583 C T 7: 6,317,555 E153K probably benign Het
Zmynd11 A G 13: 9,695,154 M243T probably benign Het
Other mutations in Tatdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Tatdn3 APN 1 191055381 splice site probably benign
IGL02819:Tatdn3 APN 1 191055344 missense probably benign 0.04
IGL02898:Tatdn3 APN 1 191046310 makesense probably null
R0718:Tatdn3 UTSW 1 191052849 splice site probably benign
R0892:Tatdn3 UTSW 1 191062805 missense probably benign 0.22
R1635:Tatdn3 UTSW 1 191060176 missense probably benign
R2018:Tatdn3 UTSW 1 191049280 critical splice donor site probably null
R2088:Tatdn3 UTSW 1 191052876 missense possibly damaging 0.59
R2243:Tatdn3 UTSW 1 191052900 missense probably damaging 1.00
R3933:Tatdn3 UTSW 1 191046324 splice site probably null
R4676:Tatdn3 UTSW 1 191049334 missense probably damaging 1.00
R5047:Tatdn3 UTSW 1 191046278 missense probably damaging 1.00
R5923:Tatdn3 UTSW 1 191049310 missense probably damaging 1.00
R6044:Tatdn3 UTSW 1 191056361 critical splice donor site probably null
R6066:Tatdn3 UTSW 1 191046268 missense probably benign 0.24
R7770:Tatdn3 UTSW 1 191058856 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCAGTGTGCTAGTGTCAGAG -3'
(R):5'- CATAGAGTATGAAAGGAGCTCACC -3'

Sequencing Primer
(F):5'- CAGCAACTGAGTGCTCTTAATGGC -3'
(R):5'- AGCTCACCAGGGTGTGTG -3'
Posted On2020-09-02