Incidental Mutation 'R8331:Polr1a'
ID644357
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8331 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71976179 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1577 (T1577M)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
Predicted Effect probably damaging
Transcript: ENSMUST00000055296
AA Change: T1577M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: T1577M

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,603,952 A545S probably damaging Het
Alox12e A T 11: 70,321,097 S195R probably benign Het
Angpt1 T C 15: 42,676,257 R69G probably damaging Het
Apob A G 12: 8,001,882 Q1149R probably benign Het
Arntl C A 7: 113,313,496 N586K probably benign Het
As3mt A T 19: 46,709,006 E71V probably damaging Het
Atp9a A T 2: 168,675,297 V372E probably benign Het
Bmp2k T C 5: 97,045,069 F259S probably damaging Het
Cacna1c T C 6: 118,630,329 T1364A Het
Casp7 T A 19: 56,440,965 I261N probably damaging Het
Ccdc151 C T 9: 21,991,711 R441H probably damaging Het
Ccdc154 A G 17: 25,167,953 K319E probably benign Het
Cdc42bpg C A 19: 6,313,447 L446I probably benign Het
Cdkl3 A T 11: 52,026,877 T334S probably benign Het
Cep250 T A 2: 155,990,253 L1366Q probably damaging Het
Chp2 G A 7: 122,221,910 D165N probably damaging Het
Ckap5 T A 2: 91,576,200 M782K probably damaging Het
Col20a1 T A 2: 180,996,766 I433N possibly damaging Het
Col4a2 A T 8: 11,413,985 R320* probably null Het
Ctsc A G 7: 88,297,120 H119R possibly damaging Het
Cubn T C 2: 13,340,242 H2121R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
D630045J12Rik T C 6: 38,148,474 E1535G probably damaging Het
Dido1 A T 2: 180,660,449 D1887E probably benign Het
Dnah6 T C 6: 73,025,000 E3903G probably benign Het
Ep300 T C 15: 81,601,210 S133P unknown Het
Ercc3 T C 18: 32,240,818 S73P probably damaging Het
Fis1 T C 5: 136,963,133 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm17087 A G 17: 8,566,707 W55R probably damaging Het
Gm3404 A T 5: 146,525,949 S41C probably damaging Het
Gm5580 T C 6: 116,552,362 I400T probably damaging Het
Greb1l T C 18: 10,458,706 S96P possibly damaging Het
Irf3 C T 7: 45,000,959 P300S probably damaging Het
Klk1b4 G A 7: 44,211,575 C214Y probably damaging Het
Krtap5-3 T A 7: 142,201,826 C133* probably null Het
Map3k12 T A 15: 102,502,331 R448* probably null Het
Map4k2 C G 19: 6,352,823 A738G probably damaging Het
Matn2 A T 15: 34,428,681 K730N probably damaging Het
Mpp3 C T 11: 102,011,715 probably null Het
N4bp2 T A 5: 65,807,600 D997E probably damaging Het
Nav2 C T 7: 49,452,623 P390S probably benign Het
Nme8 A G 13: 19,658,866 S380P probably damaging Het
Nup210 C T 6: 91,053,666 D878N possibly damaging Het
Olfr1299 A G 2: 111,664,382 D52G possibly damaging Het
Olfr896-ps1 A G 9: 38,292,085 I47V possibly damaging Het
Osbpl9 C A 4: 109,066,181 W427L probably damaging Het
Pcdhb12 T C 18: 37,437,289 V496A probably damaging Het
Pdlim1 G A 19: 40,230,551 T212I possibly damaging Het
Phc2 C T 4: 128,712,194 Q270* probably null Het
Pi4kb G A 3: 94,996,684 R527Q probably null Het
Platr25 G T 13: 62,700,903 H48Q probably benign Het
Ptprf C T 4: 118,226,066 V915M probably benign Het
Ptprh A G 7: 4,549,481 L928S probably damaging Het
Qrsl1 T C 10: 43,876,525 N434S probably damaging Het
Slc44a4 T A 17: 34,921,569 L246H probably damaging Het
Steap3 A T 1: 120,241,488 C360S possibly damaging Het
Stk10 A G 11: 32,588,928 T256A Het
Tatdn3 A T 1: 191,046,211 L261Q probably damaging Het
Thnsl1 T A 2: 21,212,174 F246L probably benign Het
Thsd7a A G 6: 12,471,158 V487A Het
Tmem41a A C 16: 21,947,366 probably null Het
Togaram2 G A 17: 71,729,226 V924M probably damaging Het
Trabd T C 15: 89,084,928 F185S probably damaging Het
Traf1 T C 2: 34,948,358 D156G probably damaging Het
Ttn T C 2: 76,880,138 E8513G unknown Het
Txlna C A 4: 129,639,486 S83I probably damaging Het
Utrn T G 10: 12,614,619 T6P probably benign Het
Vmn2r26 T A 6: 124,061,928 S821T probably benign Het
Wdhd1 A T 14: 47,272,245 probably null Het
Wnk1 T C 6: 119,953,833 I917V probably benign Het
Wscd2 A G 5: 113,550,935 M1V probably null Het
Xkr6 A G 14: 63,818,943 H357R unknown Het
Zfhx2 G T 14: 55,071,987 T885K probably benign Het
Zfp583 C T 7: 6,317,555 E153K probably benign Het
Zmynd11 A G 13: 9,695,154 M243T probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGAAGTAGACCTGTAGGC -3'
(R):5'- CAGTGTTGCACGAATGACTC -3'

Sequencing Primer
(F):5'- AAGTAGACCTGTAGGCCCCAG -3'
(R):5'- ACTCGGTAGGGTCAAGAGC -3'
Posted On2020-09-02