Incidental Mutation 'R8331:Vmn2r26'
ID 644363
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8331 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124061928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 821 (S821T)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: S821T

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: S821T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,603,952 A545S probably damaging Het
Alox12e A T 11: 70,321,097 S195R probably benign Het
Angpt1 T C 15: 42,676,257 R69G probably damaging Het
Apob A G 12: 8,001,882 Q1149R probably benign Het
Arntl C A 7: 113,313,496 N586K probably benign Het
As3mt A T 19: 46,709,006 E71V probably damaging Het
Atp9a A T 2: 168,675,297 V372E probably benign Het
Bmp2k T C 5: 97,045,069 F259S probably damaging Het
Cacna1c T C 6: 118,630,329 T1364A Het
Casp7 T A 19: 56,440,965 I261N probably damaging Het
Ccdc151 C T 9: 21,991,711 R441H probably damaging Het
Ccdc154 A G 17: 25,167,953 K319E probably benign Het
Cdc42bpg C A 19: 6,313,447 L446I probably benign Het
Cdkl3 A T 11: 52,026,877 T334S probably benign Het
Cep250 T A 2: 155,990,253 L1366Q probably damaging Het
Chp2 G A 7: 122,221,910 D165N probably damaging Het
Ckap5 T A 2: 91,576,200 M782K probably damaging Het
Col20a1 T A 2: 180,996,766 I433N possibly damaging Het
Col4a2 A T 8: 11,413,985 R320* probably null Het
Ctsc A G 7: 88,297,120 H119R possibly damaging Het
Cubn T C 2: 13,340,242 H2121R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
D630045J12Rik T C 6: 38,148,474 E1535G probably damaging Het
Dido1 A T 2: 180,660,449 D1887E probably benign Het
Dnah6 T C 6: 73,025,000 E3903G probably benign Het
Ep300 T C 15: 81,601,210 S133P unknown Het
Ercc3 T C 18: 32,240,818 S73P probably damaging Het
Fis1 T C 5: 136,963,133 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm17087 A G 17: 8,566,707 W55R probably damaging Het
Gm3404 A T 5: 146,525,949 S41C probably damaging Het
Gm5580 T C 6: 116,552,362 I400T probably damaging Het
Greb1l T C 18: 10,458,706 S96P possibly damaging Het
Irf3 C T 7: 45,000,959 P300S probably damaging Het
Klk1b4 G A 7: 44,211,575 C214Y probably damaging Het
Krtap5-3 T A 7: 142,201,826 C133* probably null Het
Map3k12 T A 15: 102,502,331 R448* probably null Het
Map4k2 C G 19: 6,352,823 A738G probably damaging Het
Matn2 A T 15: 34,428,681 K730N probably damaging Het
Mpp3 C T 11: 102,011,715 probably null Het
N4bp2 T A 5: 65,807,600 D997E probably damaging Het
Nav2 C T 7: 49,452,623 P390S probably benign Het
Nme8 A G 13: 19,658,866 S380P probably damaging Het
Nup210 C T 6: 91,053,666 D878N possibly damaging Het
Olfr1299 A G 2: 111,664,382 D52G possibly damaging Het
Olfr896-ps1 A G 9: 38,292,085 I47V possibly damaging Het
Osbpl9 C A 4: 109,066,181 W427L probably damaging Het
Pcdhb12 T C 18: 37,437,289 V496A probably damaging Het
Pdlim1 G A 19: 40,230,551 T212I possibly damaging Het
Phc2 C T 4: 128,712,194 Q270* probably null Het
Pi4kb G A 3: 94,996,684 R527Q probably null Het
Platr25 G T 13: 62,700,903 H48Q probably benign Het
Polr1a C T 6: 71,976,179 T1577M probably damaging Het
Ptprf C T 4: 118,226,066 V915M probably benign Het
Ptprh A G 7: 4,549,481 L928S probably damaging Het
Qrsl1 T C 10: 43,876,525 N434S probably damaging Het
Slc44a4 T A 17: 34,921,569 L246H probably damaging Het
Steap3 A T 1: 120,241,488 C360S possibly damaging Het
Stk10 A G 11: 32,588,928 T256A Het
Tatdn3 A T 1: 191,046,211 L261Q probably damaging Het
Thnsl1 T A 2: 21,212,174 F246L probably benign Het
Thsd7a A G 6: 12,471,158 V487A Het
Tmem41a A C 16: 21,947,366 probably null Het
Togaram2 G A 17: 71,729,226 V924M probably damaging Het
Trabd T C 15: 89,084,928 F185S probably damaging Het
Traf1 T C 2: 34,948,358 D156G probably damaging Het
Ttn T C 2: 76,880,138 E8513G unknown Het
Txlna C A 4: 129,639,486 S83I probably damaging Het
Utrn T G 10: 12,614,619 T6P probably benign Het
Wdhd1 A T 14: 47,272,245 probably null Het
Wnk1 T C 6: 119,953,833 I917V probably benign Het
Wscd2 A G 5: 113,550,935 M1V probably null Het
Xkr6 A G 14: 63,818,943 H357R unknown Het
Zfhx2 G T 14: 55,071,987 T885K probably benign Het
Zfp583 C T 7: 6,317,555 E153K probably benign Het
Zmynd11 A G 13: 9,695,154 M243T probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCAGTCTCAGCTTGCTTATTG -3'
(R):5'- AAGGTGATTAAGTTGCAGATGC -3'

Sequencing Primer
(F):5'- GCTTTTCTGGCTAGAAGGCTACC -3'
(R):5'- TTGACTACACATGACACGTTTG -3'
Posted On 2020-09-02