Incidental Mutation 'R8331:Vmn2r26'
ID 644363
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 067860-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8331 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124038887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 821 (S821T)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: S821T

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: S821T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,650,726 (GRCm39) A545S probably damaging Het
Alox12e A T 11: 70,211,923 (GRCm39) S195R probably benign Het
Angpt1 T C 15: 42,539,653 (GRCm39) R69G probably damaging Het
Apob A G 12: 8,051,882 (GRCm39) Q1149R probably benign Het
As3mt A T 19: 46,697,445 (GRCm39) E71V probably damaging Het
Atp9a A T 2: 168,517,217 (GRCm39) V372E probably benign Het
Bmal1 C A 7: 112,912,703 (GRCm39) N586K probably benign Het
Bmp2k T C 5: 97,192,928 (GRCm39) F259S probably damaging Het
Cacna1c T C 6: 118,607,290 (GRCm39) T1364A Het
Casp7 T A 19: 56,429,397 (GRCm39) I261N probably damaging Het
Ccdc154 A G 17: 25,386,927 (GRCm39) K319E probably benign Het
Cdc42bpg C A 19: 6,363,477 (GRCm39) L446I probably benign Het
Cdkl3 A T 11: 51,917,704 (GRCm39) T334S probably benign Het
Cep250 T A 2: 155,832,173 (GRCm39) L1366Q probably damaging Het
Chp2 G A 7: 121,821,133 (GRCm39) D165N probably damaging Het
Ckap5 T A 2: 91,406,545 (GRCm39) M782K probably damaging Het
Col20a1 T A 2: 180,638,559 (GRCm39) I433N possibly damaging Het
Col4a2 A T 8: 11,463,985 (GRCm39) R320* probably null Het
Ctsc A G 7: 87,946,328 (GRCm39) H119R possibly damaging Het
Cubn T C 2: 13,345,053 (GRCm39) H2121R probably damaging Het
Cyp4v3 G A 8: 45,768,745 (GRCm39) R272* probably null Het
D630045J12Rik T C 6: 38,125,409 (GRCm39) E1535G probably damaging Het
Dido1 A T 2: 180,302,242 (GRCm39) D1887E probably benign Het
Dnah6 T C 6: 73,001,983 (GRCm39) E3903G probably benign Het
Eif4a3l2 T C 6: 116,529,323 (GRCm39) I400T probably damaging Het
Ep300 T C 15: 81,485,411 (GRCm39) S133P unknown Het
Ercc3 T C 18: 32,373,871 (GRCm39) S73P probably damaging Het
Fis1 T C 5: 136,991,987 (GRCm39) probably null Het
Fscb T A 12: 64,520,242 (GRCm39) D408V probably benign Het
Gm17087 A G 17: 8,785,539 (GRCm39) W55R probably damaging Het
Gm3404 A T 5: 146,462,759 (GRCm39) S41C probably damaging Het
Greb1l T C 18: 10,458,706 (GRCm39) S96P possibly damaging Het
Irf3 C T 7: 44,650,383 (GRCm39) P300S probably damaging Het
Klk1b4 G A 7: 43,860,999 (GRCm39) C214Y probably damaging Het
Krtap5-3 T A 7: 141,755,563 (GRCm39) C133* probably null Het
Map3k12 T A 15: 102,410,766 (GRCm39) R448* probably null Het
Map4k2 C G 19: 6,402,853 (GRCm39) A738G probably damaging Het
Matn2 A T 15: 34,428,827 (GRCm39) K730N probably damaging Het
Mpp3 C T 11: 101,902,541 (GRCm39) probably null Het
N4bp2 T A 5: 65,964,943 (GRCm39) D997E probably damaging Het
Nav2 C T 7: 49,102,371 (GRCm39) P390S probably benign Het
Nme8 A G 13: 19,843,036 (GRCm39) S380P probably damaging Het
Nup210 C T 6: 91,030,648 (GRCm39) D878N possibly damaging Het
Odad3 C T 9: 21,903,007 (GRCm39) R441H probably damaging Het
Or4k49 A G 2: 111,494,727 (GRCm39) D52G possibly damaging Het
Or8c18 A G 9: 38,203,381 (GRCm39) I47V possibly damaging Het
Osbpl9 C A 4: 108,923,378 (GRCm39) W427L probably damaging Het
Pcdhb12 T C 18: 37,570,342 (GRCm39) V496A probably damaging Het
Pdlim1 G A 19: 40,218,995 (GRCm39) T212I possibly damaging Het
Phc2 C T 4: 128,605,987 (GRCm39) Q270* probably null Het
Pi4kb G A 3: 94,903,995 (GRCm39) R527Q probably null Het
Platr25 G T 13: 62,848,717 (GRCm39) H48Q probably benign Het
Polr1a C T 6: 71,953,163 (GRCm39) T1577M probably damaging Het
Ptprf C T 4: 118,083,263 (GRCm39) V915M probably benign Het
Ptprh A G 7: 4,552,480 (GRCm39) L928S probably damaging Het
Qrsl1 T C 10: 43,752,521 (GRCm39) N434S probably damaging Het
Slc44a4 T A 17: 35,140,545 (GRCm39) L246H probably damaging Het
Steap3 A T 1: 120,169,218 (GRCm39) C360S possibly damaging Het
Stk10 A G 11: 32,538,928 (GRCm39) T256A Het
Tatdn3 A T 1: 190,778,408 (GRCm39) L261Q probably damaging Het
Thnsl1 T A 2: 21,216,985 (GRCm39) F246L probably benign Het
Thsd7a A G 6: 12,471,157 (GRCm39) V487A Het
Tmem41a A C 16: 21,766,116 (GRCm39) probably null Het
Togaram2 G A 17: 72,036,221 (GRCm39) V924M probably damaging Het
Trabd T C 15: 88,969,131 (GRCm39) F185S probably damaging Het
Traf1 T C 2: 34,838,370 (GRCm39) D156G probably damaging Het
Ttn T C 2: 76,710,482 (GRCm39) E8513G unknown Het
Txlna C A 4: 129,533,279 (GRCm39) S83I probably damaging Het
Utrn T G 10: 12,490,363 (GRCm39) T6P probably benign Het
Wdhd1 A T 14: 47,509,702 (GRCm39) probably null Het
Wnk1 T C 6: 119,930,794 (GRCm39) I917V probably benign Het
Wscd2 A G 5: 113,688,996 (GRCm39) M1V probably null Het
Xkr6 A G 14: 64,056,392 (GRCm39) H357R unknown Het
Zfhx2 G T 14: 55,309,444 (GRCm39) T885K probably benign Het
Zfp583 C T 7: 6,320,554 (GRCm39) E153K probably benign Het
Zmynd11 A G 13: 9,745,190 (GRCm39) M243T probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCAGTCTCAGCTTGCTTATTG -3'
(R):5'- AAGGTGATTAAGTTGCAGATGC -3'

Sequencing Primer
(F):5'- GCTTTTCTGGCTAGAAGGCTACC -3'
(R):5'- TTGACTACACATGACACGTTTG -3'
Posted On 2020-09-02