Incidental Mutation 'R8331:Zfp583'
ID644365
Institutional Source Beutler Lab
Gene Symbol Zfp583
Ensembl Gene ENSMUSG00000030443
Gene Namezinc finger protein 583
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8331 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6315660-6331285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6317555 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 153 (E153K)
Ref Sequence ENSEMBL: ENSMUSP00000053935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062765] [ENSMUST00000108560] [ENSMUST00000165705]
Predicted Effect probably benign
Transcript: ENSMUST00000062765
AA Change: E153K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053935
Gene: ENSMUSG00000030443
AA Change: E153K

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108560
AA Change: E153K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104200
Gene: ENSMUSG00000030443
AA Change: E153K

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165705
AA Change: E153K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129551
Gene: ENSMUSG00000030443
AA Change: E153K

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,603,952 A545S probably damaging Het
Alox12e A T 11: 70,321,097 S195R probably benign Het
Angpt1 T C 15: 42,676,257 R69G probably damaging Het
Apob A G 12: 8,001,882 Q1149R probably benign Het
Arntl C A 7: 113,313,496 N586K probably benign Het
As3mt A T 19: 46,709,006 E71V probably damaging Het
Atp9a A T 2: 168,675,297 V372E probably benign Het
Bmp2k T C 5: 97,045,069 F259S probably damaging Het
Cacna1c T C 6: 118,630,329 T1364A Het
Casp7 T A 19: 56,440,965 I261N probably damaging Het
Ccdc151 C T 9: 21,991,711 R441H probably damaging Het
Ccdc154 A G 17: 25,167,953 K319E probably benign Het
Cdc42bpg C A 19: 6,313,447 L446I probably benign Het
Cdkl3 A T 11: 52,026,877 T334S probably benign Het
Cep250 T A 2: 155,990,253 L1366Q probably damaging Het
Chp2 G A 7: 122,221,910 D165N probably damaging Het
Ckap5 T A 2: 91,576,200 M782K probably damaging Het
Col20a1 T A 2: 180,996,766 I433N possibly damaging Het
Col4a2 A T 8: 11,413,985 R320* probably null Het
Ctsc A G 7: 88,297,120 H119R possibly damaging Het
Cubn T C 2: 13,340,242 H2121R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
D630045J12Rik T C 6: 38,148,474 E1535G probably damaging Het
Dido1 A T 2: 180,660,449 D1887E probably benign Het
Dnah6 T C 6: 73,025,000 E3903G probably benign Het
Ep300 T C 15: 81,601,210 S133P unknown Het
Ercc3 T C 18: 32,240,818 S73P probably damaging Het
Fis1 T C 5: 136,963,133 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm17087 A G 17: 8,566,707 W55R probably damaging Het
Gm3404 A T 5: 146,525,949 S41C probably damaging Het
Gm5580 T C 6: 116,552,362 I400T probably damaging Het
Greb1l T C 18: 10,458,706 S96P possibly damaging Het
Irf3 C T 7: 45,000,959 P300S probably damaging Het
Klk1b4 G A 7: 44,211,575 C214Y probably damaging Het
Krtap5-3 T A 7: 142,201,826 C133* probably null Het
Map3k12 T A 15: 102,502,331 R448* probably null Het
Map4k2 C G 19: 6,352,823 A738G probably damaging Het
Matn2 A T 15: 34,428,681 K730N probably damaging Het
N4bp2 T A 5: 65,807,600 D997E probably damaging Het
Nav2 C T 7: 49,452,623 P390S probably benign Het
Nme8 A G 13: 19,658,866 S380P probably damaging Het
Nup210 C T 6: 91,053,666 D878N possibly damaging Het
Olfr1299 A G 2: 111,664,382 D52G possibly damaging Het
Olfr896-ps1 A G 9: 38,292,085 I47V possibly damaging Het
Osbpl9 C A 4: 109,066,181 W427L probably damaging Het
Pcdhb12 T C 18: 37,437,289 V496A probably damaging Het
Pdlim1 G A 19: 40,230,551 T212I possibly damaging Het
Phc2 C T 4: 128,712,194 Q270* probably null Het
Pi4kb G A 3: 94,996,684 R527Q probably null Het
Platr25 G T 13: 62,700,903 H48Q probably benign Het
Polr1a C T 6: 71,976,179 T1577M probably damaging Het
Ptprf C T 4: 118,226,066 V915M probably benign Het
Ptprh A G 7: 4,549,481 L928S probably damaging Het
Qrsl1 T C 10: 43,876,525 N434S probably damaging Het
Slc44a4 T A 17: 34,921,569 L246H probably damaging Het
Steap3 A T 1: 120,241,488 C360S possibly damaging Het
Stk10 A G 11: 32,588,928 T256A Het
Tatdn3 A T 1: 191,046,211 L261Q probably damaging Het
Thnsl1 T A 2: 21,212,174 F246L probably benign Het
Thsd7a A G 6: 12,471,158 V487A Het
Tmem41a A C 16: 21,947,366 probably null Het
Togaram2 G A 17: 71,729,226 V924M probably damaging Het
Trabd T C 15: 89,084,928 F185S probably damaging Het
Traf1 T C 2: 34,948,358 D156G probably damaging Het
Ttn T C 2: 76,880,138 E8513G unknown Het
Txlna C A 4: 129,639,486 S83I probably damaging Het
Utrn T G 10: 12,614,619 T6P probably benign Het
Vmn2r26 T A 6: 124,061,928 S821T probably benign Het
Wnk1 T C 6: 119,953,833 I917V probably benign Het
Wscd2 A G 5: 113,550,935 M1V probably null Het
Xkr6 A G 14: 63,818,943 H357R unknown Het
Zfhx2 G T 14: 55,071,987 T885K probably benign Het
Zmynd11 A G 13: 9,695,154 M243T probably benign Het
Other mutations in Zfp583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp583 APN 7 6317185 missense probably damaging 1.00
IGL01921:Zfp583 APN 7 6325570 missense possibly damaging 0.95
R1593:Zfp583 UTSW 7 6317009 missense probably benign 0.03
R2188:Zfp583 UTSW 7 6317611 missense probably benign
R4377:Zfp583 UTSW 7 6317681 missense possibly damaging 0.61
R5000:Zfp583 UTSW 7 6325474 missense probably damaging 1.00
R5031:Zfp583 UTSW 7 6317398 missense probably benign
R5723:Zfp583 UTSW 7 6323675 missense probably damaging 0.98
R6603:Zfp583 UTSW 7 6325476 missense probably damaging 1.00
R7325:Zfp583 UTSW 7 6316586 missense probably damaging 0.99
R7391:Zfp583 UTSW 7 6316499 missense probably damaging 1.00
R7673:Zfp583 UTSW 7 6317010 missense possibly damaging 0.91
R8035:Zfp583 UTSW 7 6316772 missense probably damaging 1.00
R8127:Zfp583 UTSW 7 6323822 splice site probably null
RF024:Zfp583 UTSW 7 6316982 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACATTCACTACACTTCAGGATTC -3'
(R):5'- GGCAGTATGTATTCAAAGGCACAG -3'

Sequencing Primer
(F):5'- AGGATTCTCTTTTCTACCTGGAC -3'
(R):5'- GGCACAGAATTTATATCAAAGCAAG -3'
Posted On2020-09-02